Biology 111 - Problem Set 9 - Genes, Proteins, and Gene Expression Part 1 (Exam 3)

Pataasin ang iyong marka sa homework at exams ngayon gamit ang Quizwiz!

The genetic code is said to be redundant because

one amino acid can be encoded by more than one triplet codon.

You discover a new organism and analyze its DNA. If you find 40% of nucleotides are G, which of the following is true:

10% are A

Given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have?

11

Cytosine makes up 24% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?

24%

Below is a piece of double stranded DNA. If RNA polymerase is moving from left to right (direction of the arrow), what is the product? 3'-GGACT-5' 5'-CCTGA-3'

5'-CCUGA-3'

Drosophila melanogaster, the common fruit fly, has 4 chromosomes in each of its gametes. How many chromosomes are in each somatic cell?

8

Which binding site on the ribosome does the recruited tRNA bind to first?

A

The process of converting DNA to RNA is called _______.

Transcription

Different types of cells in your body look and function differently. The basis for these differences is

Different patterns of gene expression

A primary function of DNA in somatic cells is

Encoding mRNAs and subsequently proteins

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following?

Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

Which of the following statements best describes the effect a nonsense mutation would have on a gene?

It introduces a premature stop codon into the mRNA.

In his transformation experiments, what phenomenon did Griffith observe?

Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form.

A point mutation that changes a codon for an amino acid to a stop codon is called:

Nonsense mutation

Why can certain types of viruses promote cancer in humans especially?

They insert their DNA into the host genome and can cause massive damage.

Which of the following is an example of post- transcriptional control of gene expression?

all of the options

Which of these could lead to conversion of a proto-oncogene into an oncogene?

all ofthese

Proteins are polymers of what type of molecule?

amino acids

The anticodon of a particular tRNA molecule is:

complementary to the corresponding mRNA codon.

Arrange the events taking place during transcription in order: i) The pre-RNA undergoes processing ii) RNA polymerase moves downstream, unwinding the DNA iii) RNA polymerase binds to the promoter iv) RNA transcript is released and polymerase detaches from the DNA v) Polymerase initiates RNA synthesis at the start point on the template strand

iii, v, ii, iv, i

The first stage of translation and transcription is __________.

initiation

Given below is a list of events taking place during translation. Arrange these in proper sequence. i) The anticodon of tRNA base pairs with the mRNA codon at the A site ii) Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site iii) Translocation of tRNA from the A site to the P site iv) A small ribosomal subunit binds with mRNA

iv, i, ii, iii

The following question refers to this table of codons. Below is a fully processed mRNA transcript. What will be the amino acid sequence produced by translation of this message?5' GCCGCAACAUGUCUUCGUUAUCCUAGGGGUAAUAAACCCGUAUAAAAAAAAAAA 3'

met-ser-ser-leu-ser

Histone acetylation ________ transcription; whereas DNA methylation _________ transcription.

promotes; reduces

he purpose of a spliceosome is to:

remove introns and bring together exons in an mRNA molecule


Kaugnay na mga set ng pag-aaral

Physiology Unit 1 - Practice Quiz

View Set

Conduction, Convection and Thermal Radiation: Weather

View Set

Anatomy and Physiology Chapter 1 section 5

View Set

Drugs, society & behavior exam 3

View Set

Using Equations and Powers of Numbers (271-32-4)

View Set