Genetics ch. 12 hw

1) Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCGTA TCCGCCCATCCGTGGGCAT

1) The upper molecule, with a higher percentage of A-T base pairs, will have a lower melting temperature than that of the lower molecule which has mostly G-C pairs. The A-T base pairs have less stability than G-C bp as they have only 2 hydrogen bonds between them.

1) Lampbrush chromosome a) H1 histone 2) Histone b) Chromosome separation 3) Linker DNA c) Alu sequence 4) CEN region d) Polytene chromosome 5) VNTR e) Oocytes and spermatocytes 6) SINE f) Minisatellites 7) Chromosomal puff g) Lysine and arginine

1) e 2) g 3) a 4) b 5) f 6) c 7) d

1) How does super-coiling arise? What is the difference between positive and negative super coiling?

1) supercoiling arises from overwinding (positive supercoiling) or underwinding (negative supercoiling) the DNA double helix when the DNA molecule does not have free ends, as in circular ds DNA or when the ends of the linear DNA molecule are bound to proteins that prevent them from rotating around each other.

2) A diploid plant cell consists of 2*10 9 base pairs (bp). If this much of DNA is present as chromatin fibers, where each group of 200 bp of DNA is combined with histones into a nucleosome; a) how many nucleosomes are present in the cell, and b) what is the total number of histone molecules present?

2) A) 2*10 ^9 / 2* 10^ 2 = 10^ 7 nucleosomes B) Each nucleosome contains 9 histone molecules; total number of histones = 9*10 ^7

2) Describe the structure and composition of nucleosome (core particle) and chromatosome.

2) Nucleosome core particle: contains two molecules each of histone H2A, H2B, H3 and H4, which form a protein core with around 147 bp of DNA wound around the core.

3) Describe the different types of DNA sequences that exist in eukaryotes

3) 3 different types of DNA sequences exist in eukaryotes; a) Unique-sequence DNA: constitute most of the protein-coding sequences as well as a large number of sequences without any known function. One or a few copies are present per haploid genome. b) Moderately repetitive sequences: ranging from a few hundred to few thousand bp in length. Some consists of functional genes that code for rRNAs and tRNAs, but most is made up of transposable elements. Present in several thousand copies per haploid genome. c) Highly repetitive DNA: consists of clusters of tandem repeats of short sequences, often less than 10 bp in length, present in hundreds of thousands to millions of copies per haploid genome.

4) What are the three different packaging steps involved to package a fully extended DNA to a highly condensed mitotic chromosomes?

4) The first level of packing happens when DNA strands wrap tightly around the histone octomer (11 nm diameter fiber) . Numerous nucleosomes coil closely together (six-fold increase in compactness), creating the second level of packing (30 nm diameter fiber) The third level of packing occurs just before mitosis. The 30-nm fiber further condenses into 300-nm chromatin fiber. Next, the 300-nm fiber condenses into 700-nm chromatids of metaphase (value varies among organisms).

5) What is the difference between heterochromatin and euchromatin?

5) Euchromatin undergoes the normal process of condensation and decondensation in the cell cycle. It contains the majority of chromosomal material and most of the transcription takes place here. Heterochromatin remains in a highly condensed state throughout the cell cycle. It is found at the centromeres and telomeres of all chromosomes, along the entire length of the inactivated X chromosome in females and at other specific places. Most heterochromatin remains inactive during transcription.

2) In E.coli, the genetic material is composed of A) Circular, double-stranded DNA B) Linear, double-stranded DNA C) RNA and protein D) Circular, double-stranded RNA E) Polypeptide chains

A) Circular, double-stranded DNA

3) Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are A) Heterochromatin and euchromatin B) Uniform in the genetic information they contain C) Separated by large sketches of repetitive DNA D) Each void of typical protein-coding sequences of DNA E) Void of introns

A) Heterochromatin and euchromatin

6) Chromatin of eukaryotes is organized into repeating interactions with protein octomers called nucleosomes. Nucleosomes are composed of which class of molecules? A) Glycoproteins B) Histones C) Lipids D) H1 histones E) Nonhistone chromosomal proteins

B) Histones

4) In human chromosomes, satellite DNA sequences of about 170 base pairs in length are present in tandem arrays of up to 1 million base pairs. Found mainly in centromere regions, they are called A) Telomeres B) Primers C) Alphoid families D) Euchromatic regions E) Telomere-associated sequences

C) Alphoid families

1) Viral chromosomes exist in a variety of structures and can be made up of the following; A) Protein- or lipid-coding sequences B) DNA only C) DNA or RNA D) RNA only E) DNA, RNA or protein

C) DNA or RNA

7) Supercoiling relies on the enzyme A) Helicase B) DNAse C) Topoisomerase D) DNA polymerase I E) Primase

C) Topoisomerase

5) In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exist. What is it called and what types of elements are involved? A) Composite DNA, telomeres and heterochromatin B) Dominant DNA, heterochromatin and euchromatin C) Multiple gene family DNA, hemoglobin and 70s RNA D) Moderately repetitive DNA, SINEs, LINEs and VNTR E) Permissive DNA, centromeres and heterochromatin

D) Moderately repetitive DNA, SINEs, LINEs and VNTR

2) In contrast to euchromatin, heterochromatin contains more genes and is earlier replicating. T/ F

F

3) Viral genomes are always either double-stranded DNA or single-stranded RNA. T/ F

F

5) Presence of heterochromatin is characteristic of prokaryotic chromosome. T/ F

F

1) Telomerase is an enzyme involved in the replication of the ends of eukaryotic chromosomes. T/F

T

4) Polytene chromosomes are unique because they are composed of a large number of identical DNA strands. T/ F

T