NEW ULTIMATE BIOOO!!!!!
anterior pituitary hormones
"FLAGTOP FSH, LH, TSH, STH, ACTH, and prolactin
Aldosterone
"salt-retaining hormone" which promotes the retention of Na+ by the kidneys. na+ retention promotes water retention, which promotes a higher blood volume and pressure
pH= -log (4 x 10^-4)=
(4-1) . (10-4) = 3.6
transduction
(genetics) the process of transfering genetic material from one cell to another by a plasmid or bacteriophage
FSH
(males)The hormone that stimulates the sperm producing cells, To reproduce more cells, or during inhibition to stop producing more sperm. (female) Stimulates the growth of follicles in the ovary.
hypertonic
(of a solution) having a higher osmotic pressure than a comparison solution
Rh factor
+=dominant allele present -= dominant allele absent less important with AB O antibody
Gs
- GPCR stimulates adenylate cyclase which increases levels of cAMP
Glycerol 3- Phosphate shuttel
- necessary because NADH/H+ produced in cytosol during glycolysis cannot cross mitochondrial membrane to enter ETS G3PDH (cytosol) converts to G3P 1.5 ATP from each NADH NADH doesn't cross membrane Net ATP Yield=3 ATP
Postranscriptional Processing
--5' cap protects against degradation 3'AAA protects against degradation -Longer tail=better protection -removal of introns
70S Prokayotic Ribosome
-50S and-70S
Directional selection
-Adaptive pressures that lead to dominance of phenotype Giraffes with short necks can't reach leaves long necks favored
Gel Filtration
-Brands .Sephadex .Sephacryl .Cellulose .Biogel -large molecules flow more rapidly though the column and emerge first because smaller volume is ccessible to them. -a mixture of small proteins in a small volume is applied to column filled with pourous label because large protiens cannot enter intergral volume of beads and emerge sooner
Heterochromatin (Condensed)
-Condensed during interphase -Transcriptionally silent -Dark under light microscopy
DNA Replication : Prokaryotes vs Eukaryotes
-DNA unwinds at points called origins of replication generation of new DNA proceeds in both direction, creating replication forks on both sides of the orgin In bacteria the chromosome is a closed double stranded circular DNA molecule with a single origin of replication....therfore there are two replication formless that move away from each other Eukaryotic replication: as replication forks move toward each other and sister chromatids are created the chromatisds will remain connected at the centromere
Posttranslational Processing
-Folding (assisted by chaperon proteins) -Cleaving -Additon
Risk Factors of schizophrenia
-Genetic Predisposition and or Environmental, Social, and Psychological Factors -Neurodevelopmental abnormalities-----> Brain dysfunction, improper chemical balance -hypoxia
Convergent Evolution
-Independent development of similar traits -no common ancestry ex.fish and dolphins
Bipolar (Manic Depressive)
-Manai (apin onset and brief duration days -Depression (slow onset and long duration (weeks)
STOP COdon
-UAA -UGA -UAG
Euchromatin (uncondensed)
-Uncondensed during interphase -Genetically acitve -Light under light microscopy
Three things Antibodies can do to antigens
-agglutinate -opsonization -neutralizeation
Native Polyacrylamide gel electrophoresis (PAGE)
-analyze proteins in native states -limited to masstocharge masstosize ration because multiple proteins can experience same level of migration compare molecular size or charge of proteins known to be similar in size
postganglionic neuron
-autonomic cell body synapses with the
preganglionic neuron
-autonomic nervous system -CNS -axon travels to a ganglion in PNS
genetic drift
-changes in gene pool due to chance -more pronounced in small population
Centromes
-composed of heterochromatin
Oxidation of Odd-Numbered Carbon Chains
-converts to Succinyl-CoA-->Pyruvate -can be converted to glucose -Uses 5-carbon chain
Repressible Systems
-corepressor binds to repressor so that it can control to operator -aka negative control mechanism ex. Trp operon
Post translational modification
-covalent: -peptide bonds, terminus, terminus, residues -nonovalent modification -dditon of cofactor folding
positive symptoms of schizophrina
-delusion: false beliefs discordant with reality ex. TV characters as "friend" -hallucinastions Disorganized through- loosening of association -disorganized behavior: inability to carry out out activities of daily living (ex. hygiene)
Conjugated proteins
-derive funciton form covalently attached molecules called protheitic gropus ex. lip proteins direct protein to be dleivered (protehtic groups)
Native gel electrophoresis
-does not disrupt structure, but protein molecules are attracted to charged end of gel (usually positive) and are sorted based on how they move through gel if moves down it is more compact
Thalamus
-forebrain -sensory stain by acting as a relay station for all of our senses except cell sorts and transmits impules "Way Statin"
Postzygotic
-formation of zygote -hybrid incompatiblity -hybrid steritly -Hybrid breakdown when F2 generation is infertile
RNA polymerase I
-found in nucleolus -synthesizes most of rRNA
Regulation of Chromatin Structure
-histolone acetlyases add acetyl to hissing which allows histone to spread out to allow for transcription factors to come in -histone deactylases remove acetyl -dna maylases add methyl groups to nucleotides. Transcriptional machinary
Respect for persons
-honesty -informed consent -confidentiatly
Oxidation of Polyunsaturated Fatty Acids
-isomerize to aB double bond so it can compile 1 round of beta oxidation
transferases
-kinases -polymerase -inases -transferases
RNA polymerase III
-located in Neucleus -transfer rna
RNA polymerase II
-located in nucleus -Synthesiss hnRNA pre-mRNA_
Stabilizing selection
-maintain phenotypes at a tighter range (middle range) Short plants can't complete for sunlight, tall plants susceptible to wind damge
Nonsense
-makes codon a stop codon
Basic tools during protein purification
-method to quantify (assay) protein concentration -method to direct protein of interest in a mixture of proteins (activity assays for enzyme or mobility in a el)
Hydrolases
-pepsin -ase -nucleases -lipases -trypsin Reverse reaction -dehydration sysnthesis
Telomeres
-prevent essential DNA from being lost during replication -are simple repeating sequences -replaced by telomerase -form nots on chromoomes which prevents linear DNA from being degraded
Intiation
-prokaryothes -nMethoinione -eukaryotes -methiionies small ribosomal subunit is signaled by the 5'Cap (Eukaryotes) or the Shine-Dalgarno sequence (Prokaryotes -When the start codon is recognized the large subunit binds and the site P binds methane (precharged with amino acyl )
Protein Purification in protein chemistry
-properties of proteins are determined by conformation -must prevent loss of conformation (denaturation) and chemical degradation -must consider pH, contaminating enzymes (proteases) , temperature, reactivity of thiol groups
Ribosome
-protein & rRNA -3 tRNA binding sites -A site -P site -E site
Parallel evolution
-related species evolve similarly over long time period Ex.the leaves of plants
Inversion
-segment of DNA has been flipped
Histones
-small basic nucleoproteins -DNA wraps around histones to form chromatin -% histone protins in eukaryotic cells -H1 seals off the DNA as it enters and exits the nucleosome
Lyse cells from a homogenous suspension
-sonication -microfluidization
Inner ear
-starts at oval window, goes to auditory nerve vestible and semicircular canals-->cochlea-->fluid media
Insulin responce to high blood sugar
-store glycogen -build up fatty acids to store up energy
disruptive
-the two extreme phenotypes are accepted over the norm two extreme phenotypes are expressed over the norm
Source of the protein
-tissue -recombinant techniques
tRNA
-transfer RNA -has anti codon -will read along
Hydrolytic enzymes
-trypsin - arginine and lysine -chymotrysin -carboxy end of phenylalanine, tyrosine, tryptophan
Nucleotide monomers
.5 carbon sugar .Heterocyclic nitrogenous base .Phosphate groups
Four non covalent interactions stablize the double helix of DNA describe them
.Hydrophic interactions(hydrophobic effect) . Electrostatic interaction between the phosphate group .Hydrogen boding between th bases .Base stacking Vander waslls
Buffers
.are soutions of a weak conjugate acid-base pair .they are particularly resistant to pH changes, even when strong acid is added
ways regulatory facts control RNA ply II
.co activator .mediator -mediator controls the ability of RNA polymerase II to progress to the elongation stage of transcription .recruiting proteins to the promoter region that affect nucleosome positions and compositions
NMR alkane carbon
0-3
What is the approximate molarity of sodium chloride in ocean water, if the density of ocean water is 1.028 kg/L?
0.48 Fresh water can be approximated as 1 kg/1 L. The MCAT will expect us to know that the density of pure water is roughly 1 g/1 mL or 1 kg/1 L. That leaves 0.028 kg/L to be salt, which converts to 28 g/L. To convert g/L into molarity, divide by the molar mass of NaCl: 58 g/mol. 28 g/L x (1 mol/58 g) = 28/58 Round those numbers off to make it easier to work with: 30 / 60 = 0.5, which is closest to 0.48
Mechanism of Beta oxidation
1 acetyl-CoA for every 2 carbons
Transition State Stabilization
1) Sn2 reaction which creates where transition state can be favorable because of stability
Breakdown of neurotransmitters
1) acetylcholinesterase (AChE) ex. ACh 2) Neurotransmitters can be brought back into presynaptic neuron using reuptake carriers. (ex. serotonin, NE,E) 3) diffuse out of synaptic cleft (ex. Nitric oxide)
Process of DNA replication
1) lay down an RNA primer (primes) -short primer in 5' to 3' direction 2)DNA polymerase III (prokaryotes) or DNA polymerase a and d will then begin sintering the daughter strand of DNA in the 5' to 3' manner 3)DNA polymerase I (prokaryotes) or RNase H (eukaryotes) removes RNA 4) DNA polymerase I or RNAse H adds DNA nucleotides where the RNA primer has been 5) DNA ligase seals the ends of the DNa molecules together creating one counties strand of DNA
Interquartile range
1) to calc Q1...set data in order...multiple n by 1/4 2) if whole number quartile is the mean of value at postion and the next highest positon 3) if decimal round up to next number and take that as quartile positon 4) to calc Q3 multipy by n by 3/4 IQR= Q3-Q1 ex. 20, 22,22,22,23,24,25,35 8 X 1/4 = 2 Q1= 22+22/2=22 8 X 3/4= 6 Q3=24+25/2=24.5 Q3-Q1-24.5-22=2.5 more than 1.5 IQR belwo Q1 or above Q3 tf above 24.5+1.5X2.5=28.25 or below 22-1.5 X2.5= 22-3.75 is outlier
name the traits 1) XY 2)X_a Y 3)XX 4)XaX 5)XaXa
1) unaffected male 2)affected male 3normal, unaffected female 4)carrier, unaffected female 5)affected female
Glycolysis in Erythrocytes
1,3BPG---bisphosphoglycerate mutase-->2,BPG allows for oxygen to unload increase in CO2, H+, Temperature, shift to the right exceriseis is the RIGHT thing to do
Biological control agents can prevent disease in one of two main ways
1. Non-pathogens are used to compete effectively against pathogens for nutrients or space • 2. Microorganism may produce toxins that inhibits other microorganisms or insects, but not the plant
Cialdini's 6 principles of persuasion
1.) friendship/liking, 2.) commitment/consistency, 3.) scarcity, 4.) reciprocity, 5.) social validation, 6.) authority
second order
1/Concentration Vs Time
In experimental assays aprrox 93% of the 145 pm decay product is produced in the first 100 mins. If a hopsital requires at lease 250 of 145 Nd ot complete a standard image, how long before it must replace 200g sample
100-93=7%-6% ^%=o.o625 1/2^n=0.5^4=0.0625 1 halflife=100 in/4=25 250/2000=1/8 (1/2)^n=1/8 n=3 25X3=75 mins
100 kPa= to
10^5 N/m2
average molecular weight of amino acid
110 Da
If H3 has a half life of 4500 day...What fraction of starting amount of H3 will be there in 13,500 days?
13,500/4500= 3 half lives passed (1/2) (3)= 1/8
How many carbons does acetyl coA bring into the CAC
2
sn1 reaction
2 steps, leaving group leaves then nucleophile attacks carbocation formed, makes racemic mixture, wants more substituted carbon
Maleate-Aspirate Shuttle
2.5 ATP generate form each NADHA Oaloacetqte cannot bass through matrix ox-->malate> inner membrane matrix-->oxalic Net ATP Yield= 5 ATP
trisomy
3 copies of a chromosome
enzyme-linked recpetors
3 domains membrane spaning ligand binding catlytic domain
Where does DNA polymerase (taq) start replication?
3' end of primer
After two rounds of semiconservative DNA replication, the ratio of 14N to l5N will be:
3:1 semiconservative replication would give two duplexes of DNA, each containing one strand with ,5N and one strand with l4N. After the second round of replication, each hybrid duplex would generate two duplexes. One duplex would still be a hybrid (14N-I5N), but the other duplex would contain DNA that is all I4N. In the second generation, note that there are four duplexes of DNA, for a total of eight strands of DNA. Out of these eight DNA strands we see that two are ,5N and six are 14N. This gives a ratio of l4N to 15N of 3:1.
If heterozygotes cross
3:1 dominant to recessive Ww x Ww= WW, 2Ww, ww
Rapid cycling bipolar disorder
4 or more episodes in 1 year
Hydrogen Bonding
4-10 kJ/mole 30-100 times weaker than covalent interactions Todal distance between two electronegative atoms is 0.27 to 0.30 In aqueous soluiton, water can H-bond to exposed functional groups on biological molecules
transcribed mRNA sequence 5' GGCAACUGACUA 3'
5' GGCAACUGACUA 3'a
mRNA sequence to DNA 5'- GCCATAGAGCGA-3'
5'UCGCUCUAUGGC-3'
pH=pKa
50:50 (protonated: deprotonated) middle point buffer zone
how many codons?
64
Characteristics of mRNA
7-methylguanosine cap
1 atm is equal to
760mmHg = 10^5 Pa
dG
=-lnKeq
Vmax at constant concentration
=kcat[E]
Southern blot
A DNA sample is electrophoresed on a gel and then transferred to a filter. The filter is then soaked in a denaturant and subsequently exposed to a labeled DNA probe that recognizes and anneals to its complementary strand. The resulting ds labeled piece of DNA is visualized when the filter is exposed to film. mutations must create or eliminate a restriction site
bottleneck effect
A change in allele frequency following a dramatic reduction in the size of a population
doppler effect
A change in sound frequency caused by motion of the sound source, motion of the listener, or both. The intensity of the wave is affected by the surface area of the sector and distance from the source
genetic drift
A change in the allele frequency of a population as a result of chance events rather than natural selection.
degeneracy
A characteristic of the genetic code, in which more than one codon can specify a single amino aci
agonist
A chemical that mimics the action of a neurotransmitter.
acrocentric chromosomes
A chromosome with its centromere nearly at the end of the chromosome
ATP Synthase
A cluster of several membrane proteins found in the mitochondrial crista (and bacterial plasma membrane) that function in chemiosmosis with adjacent electron transport chains, using the energy of a hydrogen ion concentration gradient to make ATP. Provide a port through which hydrogen ions diffuse into the matrix of a mitrochondrion.
barr bodies
A condensed X chromosome found within the nucleus of females (or sex chromosome homozygous organisms) men do not have
diabetes mellitus
A condition in which the body is unable to produce enough insulin, the hormone required for the metabolism of sugar caused by prolonged elevated blood glucose. Sugar in the urine
diabetes mellitus
A condition in which the body is unable to produce enough insulin, the hormone required for the metabolism of sugar plenty glucose in urine (sweet smelling urine)
Discovery learning
A constructivist approach. A teaching strategy that allows students to learn by their own active exploration of a concep. Students begin learning with an activity designed to lead them to particular concepts or conclusions. Students acquire basic and advanced knowledge in random order. (Bruner's approach)
Depersonalization
A dissociative disorder whose essential feature is that the person suddenly feels changed or different in a strange way.
Sexual selection
A form of natural selection in which individuals with certain inherited characteristics are more likely than other individuals to obtain mates.
What percentage of females would be expected to exhibit red-green color blindness, if one genetic locus were involved? If the recessive trait were found in about 8% of male population.
A genetic locus refers to a given gene location on a chromosome. Males have one X chromosome (and one Y chromosome), while females have two X chromosomes. The frequency for color blindness in the male is given as 8% (0.08) in the passage. In order for females to be color-blind, they must be homozygous for the condition. The third paragraph of the passage says that red-green color blindness is sex-linked and recessive. What is the chance of a female being color-blind (i.e., homozygous for the allele)? It would just be a1, or (0.08) x (0.08), which is 0.0064 or 0.64%.
Prolactin
A hormone secreted by the anterior pituitary that tarets the mammary glands stimulating them to produce breastmilk.
What is the probability that the daughter of an unaffected father and a mother who is a carrier for the DMD gene is affected by the disease?
A is correct. The passage states that DMD is X-linked recessive, which means that a woman must have a mutated copy of the dystrophin gene on both of her X chromosomes in order to express the trait. Because the father is unaffected and will pass his X chromosome onto his daughter, there is a 0% chance that she will be affected. The father cannot have a copy of the DMD mutation, or he would be affected himself. X-linked recessive diseases are extremely rare in women.
The instance of nondisjunction for the X chromosome in females over the age of 30 is about one out of every 130 live births. If a woman over 30 gives birth to a viable baby, assuming the risk of nondisjunction from the father is negligible, what is the likelihood that it will have a normal phenotype?
A is correct. This question asks us to find the probability of a mother giving birth to have a phenotypically normal child. The chances of nondisjunction are 1/130 (0.008), or about 0.8%. If nondisjunction occurs, there is a 100% chance that she will pass on either no copies of her X chromosome and have a child with Turner syndrome (XO) or pass on two copies of the X chromosomes and have a baby with Trisomy X (XXX) or Klinefelter syndrome (see the Punnett square below). The only viable monosomy is the XO genotype. A YO genotype is not viable, meaning we cannot include it in our calculations, since the question asks us to assume a viable birth. Therefore, we simply take 1 - (probability of nondisjunction) = 1 - 0.008 = 0.992 = 99.2%. y axis (father): X vs Y x asis (mother): XX vs 0
amygdala
A limbic system structure involved in memory and emotion, particularly fear and aggression.
cholesterol
A lipid that forms an essential component of animal cell membranes and acts as a precursor molecule for the synthesis of other biologically important steroids.
Synthase
A lyase that catalyzes addition of one substrate to a double bond of a second substrate
Inclusive fitness
A measure of reproductive success; depends on the number of offspring an individual has, how well they support their offspring, and how well their offspring can support others.
Game theory
A model that explains social interaction and decision-making as a game, including strategies, incentives, and punishments.
Nonsense mutation
A mutation that changes an amino acid codon to one of the three stop codons, resulting in a shorter and usually nonfunctional protein.
introns
A noncoding, intervening sequence within a eukaryotic gene.
lysogenic cycle
A phage replication cycle in which the viral genome becomes incorporated into the bacterial host chromosome as a prophage and does not kill the host.
Missense mutation
A point mutation in which a codon that specifies an amino acid is mutated into a codon that specifies a different amino acid.
Calcitonin
A polypeptide hormone especially from the thyroid gland that tends to lower the level of calcium in the blood plasma.
Social loafing
A reduction in effort by individuals when they work in groups as compared to when they work by themselves. in the presence of others, people tend to do less, partly because they believe others will do it
transcription factor
A regulatory protein that binds to DNA and affects transcription of specific genes. guides the RNA polymerase to the promoter
Fixed ratio schedule
A schedule in which the reinforcement is presented after a specific number of responses.
third order relationship
A second- or third-order relationship at low substrate concentration would show a primarily non-linear relationship between substrate concentration and reaction velocity.
Fixed-ratio reinforcement
A set amount of behavioral responses per reinforcer. Ex: Getting a nickel for every 10 weeds pulled.
estrogen
A sex hormone, secreted in greater amounts by females than by males. In nonhuman female mammals, estrogen levels peak during ovulation, promoting sexual receptivity.
Autosomal dominant
A single allele on an autosome can cause the disorder to be seen in 50% of offspring both M and F are affected; M may transmit to M; each generation has at least one affected parent; and one mutant allele may produce the disease.
Elongation
A site-incoming tRNA complex Piste-Hold peptide holding amino acid chain. p and a bind a peptide bond forms peptidyl transfer and CTP -left as inactive molecule at E site
promoter
A specific nucleotide sequence in DNA that binds RNA polymerase and indicates where to start transcribing RNA.
promoter
A specific nucleotide sequence in DNA that binds RNA polymerase and indicates where to start transcribing mRNA.
epimers
A subtype of diastereomers that differ in absolute configuration at exactly one chiral carbon
working memory
A system for temporarily storing and managing the information required to carry out complex cognitive tasks such as learning, reasoning, and comprehension.
conjugation
A temporary union of two organisms for the purpose of DNA transfer.
confirmation bias
A tendency to search for information that confirms one's preconceptions
Sapir-Whorf hypothesis
A theory claiming that language influences perception. Example: people who are into decorating can distinguish color by descriptive adjectives i.e. pearl white.
Drive reduction theory
A theory that states that people are motivated to take action in order to lessen the state of arousal caused by a physiological need.
modeling
A therapeutic technique in which the client learns appropriate behavior through imitation of someone else.
glycerol
A three-carbon alcohol to which fatty acids are covalently bonded to make fats and oils.
apoptosis
A type of cell death in which the cell uses specialized cellular machinery to kill itself endogenous
Phagocytosis
A type of endocytosis in which a cell engulfs large particles or whole cells
pinocytosis
A type of endocytosis in which the cell ingests extracellular fluid and its dissolved solutes. A type of endocytosis in which the cell "gulps" droplets of fluid into tiny vesicles.
Cohort study
A type of epidemiologic study where a group of exposed individuals (individuals who have been exposed to the potential risk factor) and a group of non-exposed individuals are followed over time to determine the incidence of disease
Operant conditioning
A type of learning in which behavior is strengthened if followed by a reinforcer or diminished if followed by a punisher.
Classical conditioning
A type of learning in which one learns to link two or more stimuli and anticipate events
chylomicron and synthesis
A type of lipoprotein; the form in which absorbed fats from the intestines are transported to the circulatory system. has a polar surface composed of proteins (apoproteins) and phospholipid head groups which make it water soluble synthesized in the intestinal mucosa and hydrolyzed by lipase to chylomicron remnants which are taken up by the liver
procedural memory
A type of long-term memory of how to perform different actions and skills. Essentially, it is the memory of how to do certain things.
cross-sectional study
A type of research design that compares individuals of different ages to determine how they differ on an important dimension
operon
A unit of genetic function common in bacteria and phages, consisting of coordinately regulated clusters of genes with related functions.
Instinct theory
A view that explains human behavior as motivated by automatic, involuntary, and unlearned responses.
Fat-soluble vitamins
A, D, E, and K dissolve directly into chylomicrons to enter the body
posterior pituitary
ADH , oxytocin
posterior pituitary hormones
ADH and oxytocin
Complex V
ATP Synthase
Start
AUG
occupational mobility
Ability to change one's job position with regard to status and economic reward
aneuploidy
Abnormal number of chromosomes.
tropoblast
Accomplishes implantation by embedding into endometrium (outer layer)
Palmitate Synthesis
Acetyl-CoA-->Malonyl-CoA-->Palminate -Insulin stimulates palmitate Synthesis
Glycine
Achiral
thin filament
Actin
Induced Fit
Active site is complementary only after binding intuits continual changes in conformation may occur during binding catalysis and release Experimental evidnce: Competative Inhbition and X-ray crystallography
Na K ATPase
Active transport pump that contributes to assymetric of charges in the plasma membrane Na has large electrochemical gradient and K has small electrochemical gradient. ATP hydrolysis is used to transport Na and K against their electro gradient. Na K ATPase pumps 3 NA out and 2 K in. this maintains Na concentration in cytosol at 10-30 times lower than outside
dna polymerase d
Adds DNA nucleotides where the RNA primer wa
Conformity
Adjusting one's behavior or thinking to coincide with a group standard.
conformity
Adjusting one's behavior or thinking to coincide with a group standard.
Cross Nigrescence Model
African-Americans progress through stages of cultural awareness view caucausion as being more desirable
Alanine
Ala, A
alanine
Ala, A non-polar
recombinant plasmid
Allows blue/white colony screening for positive clones (i.e. plasmids that contain a DNA fragment of interest
Van der Waals Interactions
Also occurs in a distance of 0.2-0.3 nm but is transient (short-lived) and therefore weaker Weak transient range forces between .Permanent dipoles of two uncharged molecules .Permeant dipole and an induced dipole .Can be attractive or dispersive
Gabriel synthesis
Amino acids can be synthesized de novo via this reaction. through heterocyclic aromatic compound..
Enhancers
Amplify gene expression -DNA biding Domanin docs and hold on to activation domain
Bronsted-Lowry
An acid is a proton donor -must have a removale acidic proton A base is a proton acceptor -must have a pair of noboding electrons
Arrhenius
An acid is a substance that when dissolved in water , increase sthe concentration of hydrogen ions A base is substance that when dissolved in water, increases the concentration of hydroxide ions
generalized anxiety disorder
An anxiety disorder in which a person is continually tense, apprehensive, and in a state of autonomic nervous system arousal.
panic disorder
An anxiety disorder that consists of sudden, overwhelming attacks of terror
renin
An enzyme secreted by the juxtaglomerular cells when blood pressure decreases. Renin onverts angiotensinogen to angiotensin I.
Phosphatase
An enzyme that catalyzes the removal of a phosphate functional group from a protein.
kinase (two definitions)
An enzyme that phosphorylates something else. Kinases are frequently used in regulatory pathways, phosphorylating other enzymes. an enzyme that catalyzes the transfer of a phosphate group from ATP to a specified molecule.
passive immunity
An individual does not produce his or her own antibodies, but rather receives them directly from another source, such as mother to infant through breast milk
social capital
An individual's social networks and connections that may confer economic and/or personal benefits.
Lysosome
An organelle containing digestive enzymes
transgenic
An organism that has integrated recombinant DNA into its genome
habituation
An organism's decreasing response to a stimulus with repeated exposure to it
cognitive dissonance
An uncomfortable inconsistency among one's actions, beliefs, attitudes, or feelings. People attempt to reduce it by making their actions, beliefs, attitudes or feelings more consistent with one another.
bottom up processing
Analysis that begins with the sensory receptors and works up to the brains integration of sensory information
Gene knockout
Animal or organism that has a gene that has been specifically inactivated
derived from ectoderm
Anterior Pituitary medulla of adrenal glands Neural Crest EPITHELIAL nervous tissue
type I diabetes
Antibody against insulin and islet cell Insulin-dependent
stereotype threat
Anxiety and resulting impaired performance that a person may experience when confronted with a negative stereotype about a group to which they belong.
Arginine
Arg,R
Starling Forces
Arteriole end hydrostatic > osmotic net efflux of H20 Venue end Osmotic > Hydrostatic int influx of H20
From heart to veins to heart pathway
Artery-->Arterioles-->Capillaries-->Venues-->Vein-->heart
Asparagine
Asn, N
acidic amino acids
Aspartic Acid, Glutamic Acid
Hydrophobic Interactions
Association of a non-polar molecule or group with other non-polar molecules Depends upon the increased entropy (+deltaS) which occurs when water molecules surrounding a non-polar molecule are freed to interact with each other in solution the cumulative effects of many hydrophobic interactions can have a significant effect on the stability of a macromolecule
Equalization of Fluid Distribution
At the capillaries, fluid leaves the blood stream and goes into the tissues. The quantity of lid that leaves the tissues at the arterial end of the capillary bed depends on Straling forces. Oncontic pressure of blood draws water back into vessel at venue end, once hydrostatic pressure has decreased. Because net pressure drawing fluid in at the venue end is slight less than the net pressure pushing fluid out at the arterial end, a small amount of fluid remains in the tissues.
nasal retinas
At the optic chiasm, you wold not ice a pecular event known as partial decussation, wher eonly the axons of retinal ganglion cells who have their cell bodies in the __ wold cross the midline. If you were to lesion through the midline of the optic chiasm, this would sever all these aoxs, and the animal would likely los eth ebaility to percieve stimuli presented to its peripheral visual field.
What happens during the beginning of deprivation in the cells?
At the very beginning of a period of deprivation, starting just a couple of hours after a meal, the liver will use all stores of glycogen and begin gluconeogenesis in order to maintain normal blood glcose levels After 10 to 18 hours the liver will use gluconeogeesis exculsively to keep glucose in the blood for the brain to use. Since gluconeogenesis uses amino acids to make glucose there must be a rapid breakdown of muscle protein to provide the necessary amino acids The brian really needs glucose during starvation and although there will be increased ketone formation it is not a direct result of the brain's exlusive need of glucose
paramagnetic
Atom or substance containing unpaired electrons and is consequently attracted by a magnet.
dipole dipole
Attractions between oppositely charged regions of polar molecules
Salt bridges
Attractions between oppositely-charged functional groups in proetines
Water soluble vitamins
B and C absorbed into endothelial cells of the small instestinge passing directly into the plasma
germinal cneters
B-cells profligate and mature in lymph nodes
posterior
Back of the body Located behind; in the back
Three Fundamental domain
Bacteria Eukarya Archea
prokaryote examples
Bacteria and Archaea
gram-negative bacteria
Bacteria that have a thin peptidoglycan cell wall covered by an outer plasma membrane. They stain very lightly (pink) in Gram stain. Gram-negative bacteria are typically more resistant to antibiotics than Gram-positive bacteria.
exconjugants
Bacterial cell bearing a donor allele
Nucleosomes
Bead-like structures formed by histones and DNA form spirals and supercoils
Altruism
Behaviors that benefit other people and for which there is no discernable extrinsic reward, recognition, or appreciation.
ventral
Belly side
law of independent assortment
Best demonstrated by the dihybrid cross. A cross that is carried out between two individuals hybrid for two or more traits that are not one the same chromosome- resulting in phenotype ratio 9:3:3:1
Distal convoluted tubule
Between the loop of Henle and the collecting duct; Selective reabsorption and secretion occur here, most notably to regulate reabsorption of water and sodium
antagonist molecule
Binds to a receptor but blocks the neurotransmitters functioning.
repressor
Binds to the operator of an operon and prevents RNA polymerase from binding to the promoter, thus blocking transcription
osteoclasts
Bone-dissolving cells. they break down bone and release its minerals to the blood. monocytes
Turner's Syndrome
Born with a single X chromosome. (short, webbed neck, different physical sexual development.) Sterile Felmale
Alzheimer's Disease Pathology
Brain atrophy Changes to amygdala, forebrain, hippocampus, and cortex Amyloid beta-peptide accumulation Neurofibrillary tangles of hyperphosphorylated tau protein
capacitance
C = Q/V
In a population of Amish people, the frequency of the recessive autosomal allele for polydactyly is 1.2%. What percent of the population are carriers for this gene?
C is correct. We can use the Hardy-Weinberg equation to solve this question. Remember that the total number of alleles in the population has to add up to 1: A + a = 1 And the total number of genotypes in the population must also add up to 1: AA + 2Aa + aa = 1 We're told that a = 0.012. By the first equation above, A = 0.988. The carriers are the heterozygotes with the genotype Aa. Their frequency is: 2Aa = 2 x 0.988 x 0.012 = 0.988 x 0.024 At this point we've got what looks like a tough calculation to do, so we should probably back up and start estimating. Our calculation is telling us to take 98.8% of 0.024, so our answer is going to be really close to 0.024 (since 100% of any number is just that number itself [e.g. 100% of 56.7 is 56.7]). If we look at the answer choices, the only one that's remotely close is 0.0237, or 2.37%.
conflict theory
COMPETITING groups that act according to their own self interest
Amphiprotic
Can be an acid or a base .HCo3- .HSO4- H20
Knockouts
Can be used to delete a gene
Veins
Cary deoxygenated except for pulmonary and umbilical cord thin and inelastic on-way valves Skeletal muscle assists
Interphase
Cell grows, performs its normal functions, and prepares for division; consists of G1, S, and G2 phases
adherens
Cell junction that helps hold together epithelial cells in a sheet of epithelium; actin filaments inside the cell attach to its cytoplasmic face.
Metaphase
Centromeres of duplicated chromosomes are aligned at plate. Fully formed spindle attach to the sister chromatids from opposite poles
Adaptation
Chang in threshold due to environmental change when you get into a hot tub at first
founder effect
Change in allele frequencies as a result of the migration of a small subgroup of a population
monosomy
Chromosomal abnormality consisting of the absence of one chromosome from the normal diploid number
Agglutinating
Clumping together the antigen and antibody into large insoluble protein complexes that can be pahgocytized and digested by macrophages
Complex III
CoQH2-cytochrome c oxidoreductase CoQ transfers electrons to cytochrome c cytocoes : proteins with heme grooms reached to Fe2+ deoxidized to Fe3+ coQH2 diffuses through bilayer to binding site 1st e- reduced cytochrome c 2nd e-transfereed to another coQ Step 1 releases 2H to protein space A second CoQH2 attaches to biding site 1st e' transfered to CoQ from step 1 step 2 releases 2H+ to inter membrane space Input of 2H+ creates CoQH2 which diffuses out ubiquinol is being oxidized cytochrome c is being reduced ubiquinone: cytochrome c oxidoreductase; transfers electrons from QH2 to cytochrome c; protons are transferred from the matrix to the IMS
Structural
Codes for protein of interest
Regulator
Codes for repressor
Gene knockout collection
Collection of strains that represent all of the genes inactivated
Antisense Strand
Complement strand to mRNA strand
Forebrain
Complex perceptual, cognitive and behavioral processes
heterochromatin
Condensed, transcriptionally inactive ("H eteroC hromatin = H ighly C ondensed.") but has high rate of post transcriptional activity
approach-approach conflict
Conflict that results from having to choose between two attractive alternatives
Parasympatheic Division
Conserve Energy Stimulates flow of saliva contracts bladder stimulates bile release
Suprachiasmatic nucleus
Considered the 'master clock' for most of our circadian rhythms
nonstandard amino acids
Consist of amino acid residues that have been chemically modified AFTER incorporation into a polypeptide or amino acid post-translational modification
integumentary system
Consists of the skin, mucous membranes, hair, and nail, largest organ of the human body
rough ER
Covered in ribosomes and is responsible for the synthesis and transport of proteins and glycoproteins.
Dihydroxyacetone phosphate (DHAP)
Critical to triaclyglyceraol synthesis in hepatic and adipose tissue Isomerize to glycerol 3- P---->glycerol
dihybrid cross
Cross or mating, between organisms involving two pairs of contrasting traits
Extinction
Cs presented without the UCS enough times Organism becomes habituated to CS
Manic Episodes
DIG FAST Distracted, Insomnia, Grandiosity, Flight of ideas, Agitation, Pressured Speech, Thoughtlessness and risky behavior
REAL definition of southern blotting
DNA from a particular chromosome is cut into fragments using a RE and then separated using size by electrophoresis. DNA in gel is treated with a base and then denature to yield single stranded NDA nitrollose paper binds the single stranded dan and the a buffer flow is used to transfer the DNA from gel to paper. A probe containing a radiantly labeled DNA is used for hybridization to DNA on the paper. The position of the DNA fragment that anneal to probes are revealed by auto radiography
Proofreading
DNA molecules pass through part of DNA polymerase enzyme when complementary strands have incorrectly paired bases, the hydrogen bonds between the strands can be unstable lack of stability is detected as the DNA passes through the polymerase methylaton as plays a role higher mutation in leading strand
exonuclease
DNA pol III is able to correct mistakes in replication due to what function Hydrolyze phosphodiester bonds to get rid of mistakes at the end of chain
DNA polymerase II
DNA repair 3-->5
unidirectional replication
DNA replication proceeds in only 1 direction
molecular markers
DNA sequences that do not encode genes can also be mapped relative to one another, such sequences are known need to be polymorphic - show variation between at least some individuals in a population • similar to different alleles of a gene • Alleles of a gene • Restriction fragment length polymorphism • Minisatellite • Microsatellite • Single nucleotide polymorphism • Sequence-tagged site
Sense strand
DNA strand from which mRNA is synthesized during transcription
The sequences coding for ___ are the most similar for different species.
DNA synthesis
palindromes
DNA that can be read forwards and backwards where restriction enzymes cut 4-6 bp
transcription
DNA to RNA (or mRNA)
probe DNA
DNA with known sequence
Hypoxia
Deficiency of oxygen in tissues. hypoventilation
construct validity
Degree to which a test actually measures what it claims to measure accurately obtains the information that it is meant to obtain
blood flow path
Deoxygenated blood enters R atrium from superior vena cava-->inferior vena cava and coronary sinus-->blood pushed into R ventricle-->R vent. sends blood to pulmonary trunk (splits to R and L) to the lungs where it is oxygenated (pulmonary circultion)-->oxygenated blood flows from lungs to pulmonary veins to L atrium-->L vent. sends blood to body through aorta (systemic circulation)
DSM-5
Description of Symptoms but does not ave how to treat
type 2 diabetes
Diabetes of a form that develops especially in adults and most often obese individuals and that is characterized by high blood glucose resulting from impaired insulin utilization coupled with the body's inability to compensate with increased insulin production.
Why is nitrogen gas used to prevent unwanted side reactions?
Diatomic nitrogen gas is relatively inert and can be used as the atmosphere in laboratory conditions to prevent unwanted side reactions.
Pineal Gland
Diencelpahlon Biological rhythms and melatonin (regulates sleep cycle)
Posterior Pituitary
Diencephalon releases ADH and Oxytocin
Signal detection theory
Differences in perception of a stimulus based on internal and external factors ex.. ppppppppppppbpppppppp where is the b?
human somatic cell
Diploid cells that have 2 sets of 23 chromosomes, each form one of the parents.
Patterns of Evolution
Diverent Parallel Convergent
• Silent mutations
Do not alter the the amindo acid sequencey ß Degeneracy fo the genetic code ˙ Ex • UUC to UUG
Mixed Inhibition
Do not bind to active sites, only at allosteric sites. They alter the Km depending on the preference of the inhibitor. If it binds to the enzyme, Km increases, if it binds to the complex, it lowers the Km value. Vmax is decreased in all cases.
Hypomania
Does not sigignificalty impair function
semiconservative
During replication parental strands will serve as templates for the generation of new daughter strands on parental strand is retained in each of the two resulting identical double stranded DNA molecules
Glutamic acid
E
Which of the following do NOT have proteins with a nuclear localization signal? I. E. coli II. Homo sapiens III. Fungi IV. Archaea
E. coli, a bacteria, and archaea do not have nuclei, and thus do not have a need for nuclear localization signal on their proteins. Homo sapiens and fungi are eukaryotes with nuclei.
E=
E=hf
Energy equations
E=hf Energy= power x time E=hv and E=hc/wavelength and E=mc
Elastin
ECM connective tissue Strech and recoil
Inner membrane
ETC proteins located here
Eicosanoids
Eicosanoids are a large group of molecules derived from polyunsaturated fatty acids. The principal groups of hormones of this class are prostaglandins, prostacyclins, leukotrienes and thromboxanes. Arachadonic acid is the most abundant precursor for these hormones. Stores of arachadonic acid are present in membrane lipids and released through the action of various lipases. The specific eicosanoids synthesized by a cell are dictated by the battery of processing enzymes expressed in that cell.
Secondary Structure
Either an alpha helix or beta pleated sheet.
Major types of non-covalent forces
Electrostatic Hydrogen bonds Van der Waals forces
Electrostatic interactions
Electrostatic interactions between two charged particles can extend over greater distances than other forces charge repulsion occurs between similarly charged groups Weakened by water
Biological perspective
Emphasizes genetics, the roles of various parts of the brain, and the structure and function of individual nerve cells.
lac Z
Encodes for Beta-galactosidase- an enzyme whose role is to convert the disaccharide lactose to the monosaccharide glucose and galactose
epiphysis
End of a long bone
conduction
Energy is passed from atom to atom through direct contact
active transport
Energy-requiring process that moves material across a cell membrane against a concentration difference
Irreversible Inhibition
Enzyme is permanently disabled
endonuclease
Enzyme that breaks covalent bonds in the DNA backbone in recombination and repair.
peptidases
Enzymes that digest proteins (include trypsin and chymotrypsin) work mainly in the stomach because it wants to decrease high levels of H+ concentration
isoforms
Enzymes that exist in multiple forms with different enzymatic properties, and are the products of separate genes. produced by splicing of exons Tissues may express one specific isoform or may generate a mixture of isoforms.
anomers
Epimers formed by ring closure
Depressive Disorders
Episodic and severe engouh to interfere with daily functions Symptoms: Sleep disturbances, loses of interesest in activities, excessive guild, decreased, energy, difficulty concentrating, appetite disturbances, psychomotor symptoms, sucidal thoughs(SIG E CAPS)
DNA polymerase IV
Error Prone, Last resort polymerase
Hematopoiesis
Erythoropoeitn-->Bone Maroow<--Thrompbocytes
Ovulation
Estrogen concentrations spike and result in positive feedback surge in LH is important; it induces ovulation
dna polymerase e
Eukaryotic DNA polymerase that replicates the leading strand during DNA synthesis
prokaryotic vs eukaryotic
Eukaryotic is made up of cells and Prokaryotic is any cellular organism that has no nuclear membrane and no organelles in the cytoplasm except ribosomes.
Enzyme and Temperature
Every 10C increase doubles rate of reaction
convergent evolution
Evolution toward similar characteristics in unrelated species
subjective bias
Experimenter biases
extrons
Expressed sequence of DNA; codes for a protein.
Pierre Flourens
Extirpation: parts of the brain are surgically removed and behavior consequences observed (ablations... conclusion was brain had specific parts for specific functions
Two red beetles are crossed and produce 31 red and 9 brown offspring (F1 generation) If two red F1 battles are crossed, what is the probability that both red and brown beetles will appear in the F2 generation
F1= 3:1 both heterozygous F2: 25% red (homozygous dominate), 50% red (heterozygous), and 25% brown (homozygous recessive) If two red F1 battles are crossed and both red and browns beetles appear in the F2 generation, the F1 red beetles that were crossed must both be heterozygotes. the prpabiltiy that of the red F1 battles, both were heterozygous is 2/3 X 2/3 , or 4/9 (only red beetles were heterozygous)
If the current flowing through the conducture, the magnitude of the foce acts on the conductor is
F=BiL
Anterior Pituitary
FLAT HEAD FSH LH ACTH TSH prolactin endorphins GH
Which hormones primary act on the ovaries?
FSH, LH, and hCG
Differential reproductuion
Favorable mutation is more likely to pass on to next generateion
Anxiety Disorders
Fear severity Longer Direction Trigger Disruption of Function
Ff is equal to
Fg or µ X Fn
How would our respiratory systems adjust if we moved to higher altitudes where less oxygen is available?
First, we would breathe more rapidly to try to avoid hypoxia Second the biding dynamics of hemoglobin to oxygen would be altered to facilitate the unloading of oxygen at the tissues.
Describe how you could produce many copies of the β-globin cDNA from the rat using RT-PCR.
First, you would isolate mRNA from rat red blood cells. The mRNA would be mixed with reverse transcriptase and nucleotides to create a complementary strand of DNA. Reverse transcriptase also needs a primer. This could be a primer that is known to be complementary to the β-globin mRNA. Alternatively, mature mRNAs have a polyA tail, so one could add a primer that consists of many T's, called a poly-dT primer. After the complementary DNA strand has been made, the sample would then be mixed with primers, Taq polymerase, and nucleotides and subjected to the standard PCR protocol. Note: the PCR reaction would have two kinds of primers. One primer would be complementary to the 5ʹ end of the mRNA and would be unique to the β-globin sequence. The other primer would be complementary to the 3ʹ end. This second primer could be a poly-dT primer or it could be a unique primer that would bind slightly upstream from the polyA-tail region
classes of immunoglobin
Five classes of immunoglobins have been identified in humans and other higher vertebrates: IgG, IgA, IgM, IgE, and IgD
Leakage
Flow of genes between species
FRAP
Fluorescence Recovery After Photobleaching; showed that the cell membrane is fluid; rate of diffusion of lipids can be measured as well as the movement of specific fluorescently labelled molecules
Chemiosmotic Coupling
Fo is in the membrane F1 spins and takes protons form inter membrane space and pumps through in an exergonic reaction which creates ATP which is an endergonic reaction
Newton's Third Law
For every action there is an equal and opposite reaction
Keratin
Found in epithelial cells mechanical integrity of cell Function as regulatory protein Hair and nails
anterior
Front
Aldolase
Fructose 1,6 bis P---> DHA and GAH
Which species have nuclear localization signal?
Fungi and Homo sapiens because Ecoli and Archea do not have a nuclei
cell cycle
G1, S, G2, and M
interphase
G1, S, and G2 longest part of the cell cycle
Mismatch repair
G2 pause of cell cycle enzymes endowed by genes MSH2 and MLH1 - detect and remove errors missed during S phase
Net ATP Yield
G3P--> 3 ATP Malate aspartate shuttle---> 5 ATP Glycolysis= 5-7 ATP 2 Pyruvate--> 25 ATP Aerobic respiration= 3-=31 ATP
muscarinic Ach
GPCR that act through 2nd messenger Acetylcholine receptor type found postganglionic synapses of the parasympathetic nervous system
Hill Coefficient
Gamma, which represents the steepness of the curve for the concentration/dose vs effect curve. This is included in the sigmoidal Emax model greater than 1= cooperatively lower or equal to 1= no cooperativity
gluconeogensis
Generation of glucose from non-carbohydrate carbon substrates such as pyruvate, lactate, glycerol, and glucogenic amino acids. occurs when store carbs are low
Depressive Disorders Risk Factors
Genetics Life style Highly active amygdala Atrophied Hippocampus Catecholamine Hypothesis High cortisol Decrease in serotonin, norepinephrine, and dopamine
Law of Closure
Gestalt Principle. When a space is enclosed by a contour, it tends to be perceived as a complete figure.
Glutamine
Gln, Q carrier of nitrogen byproducts from most tissues in the body
non polar amino acids
Glycine, Alanine, Proline, Valine, Leucine, Isoleucine
Cardiac output
HR * Stroke volume (SV)
hypotonic
Having a lower concentration of solute than another solution
Denaturing dna
Heat alkaline pH formaldehyde
Glucokinase
High Km (acts when glucose is abundant Present in hepatocytes and pancreatic B-islets cells (Acts as glucose sensor with GLUT 2) Induced by insulin in hepatocytes trap glucose in cell
YACs and BACs are commonly the first step in creating a rough physical map of the genome
Higher resolution achieved by cloning smaller pieces • Smaller pieces are cloned into other vectors such as cosmids
Limbic System
Hipocampus
nucleosome
Histone core (H2A, H2B, H3, and H4) with DNA wrapped around
Prophase of meiosis I
Homologous pair chromosomes share information; crossover spindle apparatus formation genetic recombination
John Dewey
How mental process help individuals adapt to their environments functinalism
Functionalism
How mental processes help individuals adapt to their environments
William James
How the mind adapts to the environment functionalism
Salinity
Hydrogen and ionic bonds may be disrupted which can change the con. of enzyme
gonadotrophin-releasing hormone (GnRH)
Hypothalamus--> increase in GnRH---> pituitary--> increase in FSH--> Ovary--> follicle begins to mature-->Estrogen--> Uterus-->Vascularization of the uterine wall
Isoleucine
I, Ile
Difference between DNA and RNA
If 2' is OH it is RNA
Which of the following would be the appropriate antisense mRNA sequence to block the function of a gene that has the DNA sequence: 5' - GAAGGCCGT - 3' on the strand that is directly read?
If the original DNA template is: 5' - GAAGGCCGT - 3' Then the sense mRNA transcribed from that DNA would be: 5' - GAAGGCCGT - 3' - DNA 3' - CUUCCGGCA - 5' - sense RNA To then create an antisense mRNA which would bind to the sense mRNA we would need: 5' - GAAGGCCGT - 3' - DNA 3' - CUUCCGGCA - 5' - sense RNA 5' - GAAGGCCGU - 3' - antisense RNA This matches choice A. Note that choice A is written 3' to 5' so to match our work to choice A, we have to read choice A backwards. 3' - UGCCGGAAG - 5'
Double approach-avoidant conflicts example of jurors in the study likely experiencing if they are unsure of the defendant's guilt
If they ruled the defendant guilty, then they could be punishing a criminal(approach) or maybe punishing an innocent(avoidant). If they ruled the defendant innocent, then they would be letting a criminal walk away unpunished(avoidant) or freeing an innocent (approach).
ionization trend
In a Period: Values from left to right generally increase, the nuclear charge increases and the electrons are more strongly attracted
conjugation
In bacteria, the direct transfer of DNA between two cells that are temporarily joined.
If hemoglobin is 65,000 amu and Iron is 55.8 amu....What is the percentage of Iron?
In order to find the percentage of iron in hemoglobin, we must first find the mass of iron in hemoglobin and then divide that value by the mass of hemoglobin itself. Information needed to do this is given in the passage. The quotient is multiplied by 100% to give the desired answer. Since each globin protein has one iron atom, and each iron atom has a molecular weight of 55.8 amu, we multiply 4 iron atoms by 55.8 amu to get an overall iron mass of about 223 amu. We next divide this value by the molecular weight of hemoglobin, which is about 65,000 amu. This gives a value of 0.0034. Multiplying this value by 100% gives an overall percentage of iron in hemoglobin of 0.34%
lariat
In self-splicing introns, the intron forms a this structure
If 6% of all males who are color blind have a deutan defect ( green blindness recessive) gene and 8 % of the male population is color blind, 0.4 % of incidence of color blindness in women, and incidence in men for red color blind (proton color blindness) is 2%. What percentage of female would be heterozygous carries of proton color blindness?
In the passage we learn that about 6% of all males who are color-blind have the deutan defect while 2% of all males who are color-blind have the protan defect. In a heterozygote, the dominant allele is /; and the recessive allele is q. We see that q = 2% = 0.02 and that /; = 98% = 0.98. From the Hardy-Weinberg equation, we find that !pq = 2(0.98)(0.02) = 0.0392 x 100% = 3.92% or about 4%. Note that the percentage of heterozygote women who are carriers of deutan color blindness is 2(0.94)(0.06) = 0.1128 x 100% = 11.28% or about 11%. If we add 11% + 4%, then we get 15%, which is roughly the percentage of women who carry the color blindness defect.
Modern Synthesis Model
Includes genetic inheritance and gene pool changes
hyperaldosteronism
Increased aldosterone cause Na retention and K and H excretion so: hypernatremia, hypokalemia, metabolic alkalosis, HT
Insulin in blood stream causes
Increased glycogen synthesis B. Increased lipid synthesis C. Increased esterification of fatty acids D. Decreased gluconeogenesis Insulin is secreted in response to high blood sugar. If the body detects that there's plenty of blood sugar, then it would want to stop making more sugar (eliminate choice D), it would want to store that sugar as glycogen (eliminate choice A), and it would want to build up fatty acids into fats for storing up energy (eliminate choice C). The thing the body is LEAST likely to do is to stop storing up energy (choice B). In general, think of the function of insulin as causing the body to build up large molecules to store up energy (glycogen, lipids) and to stop the body from breaking down large molecules to provide energy.
Increased density of inhibitory serotonin auto receptor 5-HT1A on the presynaptic membrane results in which of the following?
Increasing the density of an inhibitory receptor on the pre=synaptic membrane means that it is more likely that the function of the pre-synaptic embrane will be disabled. The function, of course, of the pre-synaptic membrane in cell signaling is to release neurotransmitter into the synaptic cleft. If this function is not being perforemed then the availabilty of that neurotransmitter will decrease.
Divergent
Independent develop of dissimalr traits from common ancestor ex.seals and cats
Sherrington
Inferred the existence of synapses
Mixed inhibition
Inhibitor can bind to enzyme substrate complex preventing the soubrette from binding initially or will released if binds to enzyme it will increase Km if bind to enzyme substrate it will decrease km
derived from endoderm
Inner surface of stomach branchial pouches bladder lining Prostate
endometrium
Inner, mucous membrane lining of the uterus
Yeast artificial chromosomes (YACs)
Inserts can be several hundred thousand to 2 million bp long
P1 artificial chromosomes (PACs)
Inserts can be up to 300,000 bp long
Beta cells
Insulin is produced by cells of the pancreatic islets called also secrete amylin
If you want to prevent cellular replication at what stage of mitosis should you halt?
Interphase
phagosome
Intracellular vesicle containing material taken up by phagocytosis.
transgenes
Introducing recombinant DNA that contains and expresses specific genes or alleles
Tertiary Structure
Irregular contortions of a protein molecule due to interactions of side chains involved in hydrophobic interactions, ionic bonds, hydrogen bonds, and disulfide bridges.
tertiary structure
Irregular contortions of a protein molecule due to interactions of side chains involved in hydrophobic interactions, ionic bonds, hydrogen bonds, and disulfide bridges.
What does 'post-genomic era' means?
It simply refers to the fact that we now live in a time where it's a simple matter to decode and access entire genomes - that is, the complete and total genetic makeup of an organism.
desmosome
Join two cells at a single point, attach directly to the cytoskeleton of each cell. Found in tissues that normally experience a lot of stress due to sliding.
Ka relationship to Keq
Ka= Keq
dG > 0
Keq <1
dG < 0
Keq > 1
Michaelis-Menten relationship
Km=k2+k3/ k1
Luteal Phase
LH causes the ruptured follicle to form the corpus letum, which secretes prgesterone progesterone levels begin to rise, while estrogen levels remain high high levels of progesterone cause negative feedback on GnRH, FSH, and LH preventing ovulation of multiple eggs
Ischemia
Lack of blood supply
A-band
Length of Thick filament
Leucine
Leu, L
triglycerides
Lipids containing a glycerol molecule attached to three fatty acid chains; chemical form in which most fats exist in food and in the body, used as longterm storage of energy.
lipid raft
Lipids move freely in the plane of the membrane and can assemble help localize signal transduction
Promotor
Location where RNA polymerase binds
microfilament
Long, thin fibers that function in the movement and support of the cell
Microfilaments
Long, thin fibers that function in the movement and support of the cell ex.actin
Blood Pressure Regulation
Low BP--> Baroreceptors-->Brain (aldosterone Release)--> increase in blood volume -->increase in BP High Osmolarity-->Chemoreceptors-->Brian (ADH please)--> increase in Blood Volume and blood pressurem= decrease in osmolarity or Hi hg BP-->Baroreceptors-->Brainn--> (decrease in sympathetic impulses--> secretion of ANP (a weak diuretic)---> decrease in BP
Lysine
Lys K basic
basic amino acids
Lysine, arginine, histidine
Monocytes in an organ
Macrophages
Bacterial (Extracellular Pathogen Infections)
Macrophages engulf bacteria and release inflammatory mediators cytokines attract inflammorty cells mast cells are activated CD4+T cells are activated
reducing disaccharide
Maltose and Lactose α-D-fructose, β-D-glucose, α-D-glucose contains hemi acetal group
Alternative Splicing
Many proteins can be made form a limited number of genes
Opsonization
Marking the pathogen for destruction by other white blood cells imeediately
Includsive fitness
Measure of organism's success by # of offspring, ability to support offspring -adults scarifies self to have young survigve
Telophase (mitosis)
Membrane reforms
eposodic memory
Memory of personal experiences (most common impairment)
mRNA
Messenger RNA (mRNA) is a large family of RNA molecules that convey genetic information from DNA to the ribosome, where they specify the amino acid sequence of the protein products of gene expression.
Homologous recombination
Middle of molecule recombined • Ends of molecule lost • Neomycin resistant, gangcyclovir resistant
TCA cycle location
Mitochondria Matrix
Protons in ETC in human are ejected where?
Mitochondrial inter membrane space
Prostaglandins
Modified fatty acids that are produced by a wide range of cells. derived from arachidonic acid eicosanoids uterine contranctions, pbronchodilation, pain reducer
Proximal convoluted tubule
Most of the glomerular filtrate is reabsorbed in the
recessive mutations
Most radiation-induced genetic mutations . Inactivating mutations:
Asparagine
N
complex I
NADH-CoQ oxidoreductase NADH transfers electrons to Co enzyme Q FMN will cary NADH+ will then trnasfeter to Fe-S to reduce and 2H+ transferred to Coezyme ubiquinone and causes reduction of that
Complex I
NADH-CoQ oxidoreductase, transfers e- from NADH to Q → QH2; uses Fe-S and flavoprotein, 4H are pumped out
autosomal dominant
Name the pattern of genetic transmission characterized thus: both M and F are affected; M may transmit to M; each generation has at least one affected parent; and one mutant allele may produce the disease.
autosomal recessive
Name the pattern of genetic transmission: both M and F are affected; M-to-M transmission may be present; both parents must be carriers; the trait skips generations; two mutant alleles are needed for disease; and affected children may be born of unaffected adults?
When antibodies bind to their targets one of three can happen
Neutralizing the antigen, making the pathogen or toxin unable to exert its effect on the body Marking the pathogen for destruction by other white blood cells immediately Clumping together the antigen and the antibody into large insoluble protein complexes that can be pahgocytized and digest by macrophages
organic base
Nitrogenous coompound in nucleic acid: adenine, thymine, uracil, cytosine, guanine are examples.
adiabatic
No heat exchange
catecholamines
Nonrephinhrine and epinephrine= synthesized by the chromatin cells of the adrenal medulla dopamine, norepinephrine, epinephrine
Operator
Nontranscribable region that binds repressor
Northern blot
Northern blotting involves the use of electrophoresis to separate RNA samples by size and detection with a hybridization probe complementary to part of or the entire target sequence. The term 'northern blot' actually refers specifically to the capillary transfer of RNA from the electrophoresis gel to the blotting membrane
Prophase (mitosis)
Nuclear membrane disintegrates
How are nucleic acids separated in gel electrophoresis?
Nucleic acid phosphate groups give each nucleotide a uniform negative charge, all strands of nucleic acid would migrate the same distance in electric field if they encountered no resistance. during electrophoresis, however, the strands must migrate through a porous agarose gel, which impedes the progress of larger segments and separates strands by size Since DNA has a negative charge (overall) the negatively charged DNA fragments would move towards the anode.
At the end of ETC (before ATP production)
O2 is reduced to form H20
Osmotic Pressure of 0.2 M CaCl2
OMP= (0.2) (3 ions)(R)(T)
type 1 diabetes
Occurs most often in children & young adults: Pancreas produces little or no insulin; Onset is rapid, increase in thirst & urination, constant hunger, weight loss, blurred vision, and extreme fatigue. Treated with daily insulin therapy, healthy eating, & exercise
Humanist theory
One of the three personality perspectives. Focuses on healthy personality development. Humans are seen as inherently good and as having free will, rather than having their behavior determined by their early relationships. Developed by Carl Rogers. place emphasis on positive human potential and seeing the world through the persons eyes and viewpoints example a patient
Fluid intelligence
One's ability to reason speedily and abstractly; tends to decrease during late adulthood.
If a 65-kg man undergoes a turning acceleration of 5 m/s2 during a running turn, what is the magnitude of force experienced by the foot due to the ground?
Only the magnitude matters, so we need not worry about sign or angle direction. Now, what's needed is the hypotenuse of a triangle with legs of Fg = (65)(10) = 650 N and F = (65)(5) = 325 N. The combined vector will be bigger than either component alone, so eliminate choices A and B. This calculation can be approximated as √(3002 + 7002) = √(90000+490000) = √(580000) = √(58 x 104) = √(58) x 102. This falls between 700 and 800, meaning that choice C must be correct (the actual value is 761).
type II diabetes
Onset related to obesity and heredity. Failure of the signal transduction system to elicit a response to insulin or inadequate insulin production.
epidermis
Outer layer of skin
pentose phosphate pathway
Oxidative phase In this phase, two molecules of NADP+ are reduced to NADPH, utilizing the energy from the conversion of glucose-6-phosphate into ribulose 5-phosphate. Non-oxidative phase NADPH is used to make ribose of nucleotides
Probability of Two independent events co-occuring
P(A and B) P(A) X P(B)
probability of at least one of tow events occurring
P(A) + P(B)- P(A and B)
Power equation
P=W/t P=Fv P=intensity X area
SA node
Pacemaker of the heart
Palmitate oxidation
Palmitate--->activation--->fatty acyl-carnite-->mitocondrial matrix--->fatty acyl CoA-->Acetyl CoA
amygdala
Part of the limbic system, responsible for the emotional reactions of fear and anger.
self-serving bias
People's tendency to ascribe their positive behaviors to their own internal traits, but their failures and shortcomings to external, situational factors.
Phenylalanine
Phe, F
What are two elements that we can use to discriminate between nucleic acids and proteins (respectively)?
Phosphorus and Sulfur
Describe how protons are distinguished in NMR spectroscopy
Photos are distinguished when they absorb magnetic energy at different field strengths . Delocalized electrons generate magnetic fields that can either shield or deshield nearby protons
eukaryote examples
Plants, animals, fungi, protists
PTH
Plasma ca+2 decreases---> increase in PTH-->Vitamin D---> GI Ca absorption---> GI phosphate absorption--> plasma phosphate increases which decrease plasma Ca
half equivalence point
Point here exactly one half of the acid has been neutralized by the base in weak acid/strong base titration: [HA] = [A⁻]. Represented by part of graph that is a (quasi) horizontal line. "Buffer" region.
gap junctions
Points that provide cytoplasmic channels from one cell to another with special membrane proteins. Also called communicating junctions. found in heart and smooth muscle
Eustress
Positive stress A positive stress that energizes a person and helps a person reach a goal
cortical collecting duct
Primary site of sodium ion reabsorption at the distal end of a nephron The main region of aldosterone action is the
Semispecific approach
Primers recognize a repetitive DNA sequence found at several sites within the genome - Many different DNA fragments will be amplified
Gestalt principles
Principles that describe the top-down processing that organizes sensory information into distinct forms (nearness, similarity, common region, closure, continuity, figure & ground).
Confidence
Probability of correctly failing to reject a true null hypothesis
translation
Process by which mRNA is decoded and a protein is produced
transformation
Process in which one strain of bacteria is changed by a gene or genes from another strain of bacteria
transformation
Process in which one strain of bacteria is changed by a gene or genes from another strain of bacteria The incorporation of new genes into a cell from DNA that the cell takes up from the surrounding environment.
DNA polymerase I
Prokaryotic only. Degrades RNA primer and fills in the gap w/ DNA. (excises RNA primer w/ 5'--<3' exonuclease) <img src="70a - DNA replication.JPG" />
Secondary Structure and proline
Proline will introduce kind in petite chain when found in a-helix more found in a-HHelices across membrane proline is often found between turns of B-shee and reside of a helix
Lock and Key Model
Proposes the active site is complementary to the substrate Any enzymatic change for action must occur after binding substrate Weekended by competitive inhibition , promiscuous reactive (some enzymes catalyze multiple reactions with dif sub), Reverse catalysis
native gel electrophoresis
Protein molecules are attracted to a charged end of a gel (usually the positively charged end) and are sorted into distinct bands based on how well they can move through the gel (based on either size or charge) Stronger/more charged or smaller proteins move fastest through the gel
How are proteins separated in gel electrophoresis?
Proteins are large enough that they cannot be separated using pores and are unique in that they can be separated by isoelectric point
Bronsted Lowry base
Proton acceptor
glutamine
Q
Arginine
R
Erythrocytes
RBC Ox carrier no nucleus or mitochondria hematopoietic stem cells all energy from glycolysis
Initiation
RNA polymerase II locates promotor reginon-->TATA box -Transcription factors help wi/locating and binding -No RNA primer required to initiate transcription
translation
RNA-->Protein
colors of visible light, in order of creasing energy and frequency
ROYGBIV red, orange, yellow, green, blue, indigo , violet
Types of ray in increasing order
Radio>Microwave>Infrared>Visible>UV>X-ray>Gamma Rays
urea cycle
Rate limiting enzyme = carbamoyl phosphate synthetase 1- found in the mitochondria CO2 + NH3 -> Carbomoyl phosphate + Ornithine -> Citrulline + Aspartate -> Argininosuccinate -> Arginine + Fumarate -> Ornithine + Urea occurs in liver
primacy effect
Recall is strongest for items at the beginning of a list.
recency effect
Recall is strongest for items at the end of a list.
reducing conditons
Reducing conditions in this context means using beta-mercaptoethanol (2-ME) or dithiothreitol (DTT) to reduce disulphide bridges in proteins so that they can adopt random coil conformation and better separate by size in SDS-PAGE gels. This is a frequently used approach in protein electrophoresis for their detection by Western blotting.
Fixed interval schedule
Reinforcement occurs after a predetermined time has elapsed.
Physical mapping
Relies on DNA cloning techniques Genes are mapped relative to each other Distances computed in number of base pairs Clone pieces of DNA from a chromosome into a vector • Characterize the clones for size • Match the cloned DNA to other cloned DNA fragments (usually by Southern blotting or DNA sequencing) • Repeating the process until all DNA of interest can be found on clones that overlap (a contig - contiguous region of DNA) • Physical mapping is a massive effort, requiring large consortia of scientists The ultimate goal of physical mapping is to obtain a complete contig for each chromosome in a genome • Geneticists can then correlate cloned DNA in a contig with genetic markers obtained from linkage or cytological methods
Linkage mapping
Relies on genetic crosses Genes are mapped relative to each other Distances computed in map units (or centiMorgans)
.Cytogenetic mapping
Relies on microscopy Genes are mapped relative to band locations
Why is irreversible inhibition more permanent than "reversible noncompetitive inhibitor"
Removing non competative inhbitors reverse their inhibition, but removing irreversible inhibitors does not
dna polymerase g
Replicates mitochondrial DNA
An E value
Represents the number of times that a match or a better one would be expected to occur simply by random chance. • The lower the E value the more significant the match
germ cells
Reproductive cells that give rise to sperm and ovum haploid
flip flop lipid
Requires the polar head group of a lipid to traverse the hydrophobic core of the membrane
G0
Resting phase post mitosis - no cell division occurs
Quaternary Structure
Results from two or more polypeptide subunits.
quaternary structure
Results from two or more polypeptide subunits.
Variable-ratio reinforcement
Rewards according to a random number of behaviors. Results in very high performance.
Variable-interval reinforcement
Rewards according to random times. Results in moderately high and stable performance.
Blood flow pathway
Right Atrium--> Tricuspid value--> right ventricle-->pulmonary artery-->lungs--> ox--> pulmonary veins -->left atrium-->bicuspid-->left ventricle-->aorta (systemic--> does.--> superior vena / inferior-->right atrium
SDS gel electrophoresis
SDS denatures proteins and coats them with negative charges. beta mercaptoethanol breaks S-S bonds. migration in the gel becomes a function of the molecular weight of the protein monomers.
the Stroop effect
Selective attention to properties ex. reading color name but cannot read color word
Stem cells have two common characteristics
Self-renewal - capacity to divide. • When a stem cell divides, one daughter cell may remain undifferentiated • Other can differentiate into a specialized cell type • Population of stem cells remains constant
Recombinant DNA introduced into embryonic cell line
Self-renewing • Can grow in lab and be introduced into developing embryo • Has potential to develop into any kind of cell
Z disc
Separates the sarcomeres from each other
Serine
Ser, S
Anterior Hypothalamus
Sexual
group polarization
Shifts or exaggeration in group members' attitudes or behavior as a result of group discussion.
conserved sequence
Similar or Identical Sequences
agonist molecule
Similiar enough to a neurotransmitter to bind to its receptor and mimic its effects
During DNA replication, the base sequence 5'- pApTpApGpApC-3' would give rise to which of these complementary base sequences?
Since DNA is antiparallel, the complementary strand must be 5'-pGpTpCpTpApT-3*.
Social constructionism
Social constructionism asserts that people develop understandings and knowledge of the world through interactions with other people, and that the mediating force in this interaction is primarily language. Thus, under social constructionism ideas about gender are not inherent in the nature of reality itself, but are socially constructed and transmitted every day through countless language-based interactions between members of society. Choice D offers a good example of social constructionism in which a woman's behavior is shaped by her socially constructed sense of what it means to "be a good girl. hinges on social interaction. Thus a single person living in total isolation would not generate the same sorts of knowledge, understanding, or behavior as someone in a society.
symbolic interactionsim
Social interactions that take place using shared symbols such as words,gestures, or rituals.
Fractionation of protein by column chromatography
Solid phases re generally built from polysaccharides
Broca
Specific function impairments could be linked with specific brain
Non-covalent forces
Stabilization of proteins and nucleic acid Recognition of one biopolymer by another binding of reactants to enzymes
Generalization
Stimuli similar to the CS become able to produce CR... becomes frightened with sound
cardiac muscle
Striated muscle fibers (cells) that form the wall of the heart; stimulated by the intrinsic conduction system and autonomic motor neurons
ferromagnetic
Substances that can become magnetized; iron, nickel & cobalt. Their atoms will form magnetic domains.
Complex II
Succinate-CoQ oxidoreductase Succinate transfers electrons to coenzyme Q Aka succinate dehydrogenase Direct link to citric acid cycle Succinate + FAD----> Fumerate + FADH2 FADH2 + Fe-S ox ---> FAD + Fe-S reduced Fe-Sreduced + CoQ +2H+ ---> Fe-S oxidized + Co QH2 so basically 2H+ transferred to co enzyme Q (ubiquinone) Succinate-CoQ oxidoreductase; receives e- from succinate NO PROTON PUMPING OCCURS
Elongation
Synthesis is always 5' to 3' Primary transcript-->hnRNA
adrenal cortex
Synthesizes glucocorticoids and mineralocorticoids and secretes small amounts of sex hormones.
blood pressure equation
Systolic pressure over distolic pressure BP = cardiac output x total peripheral resistance
torque
T=Fd
thyroid hormone regulation
TRH (hypothalamus)-->TSH (pituitary)-->stimulation of follicular cells of thyroid
Cerebral Cortex
Telencephalon Frontal
Basal Ganglia
Telencephalon Middle of brain coordinate muscle relays to CNS Malfunction= Parkinson's disease (uncontrolible movement) Obsessive compuslive disorder/Skitz
Termination
Termination factors hydrolize chain
Prophase of meiosis II
Tetrad formation occurs during this phase of Meiosis
Law of Common Fate
The Gestalt principle that we tend to group similar objects together that share a common motion or destination
multiple cloning site (MCS)
The MCS is located within the LacZ gene. Insertion of a DNA fragment into the MCS will disrupt (mutate) the LacZ gene, blocking its function.
antibody structure
The Y-shaped molecule is composed of two light chains and two heavy chains linked by disulfide bridges (S—S). Most of the molecule is made up of constant regions (C), which are the same for all antibodies of the same class. The amino acid sequences of the variable regions (V), which form the two antigen-binding sites, differ from molecule to molecule
Binocular vision
The ability to merge visual images from both eyes, thereby providing depth perception and a three dimensional view of the world.
social mobilty
The ability to move up in social class
glycoside
The acetyl or ketal of a sugar
variable regions
The antigen binding fragment of an immunoglobulin molecule, consisting of a combination of heavy and light chains whose molecular conformation is specific for the antigen
electromagnetic
The arrangement of waves of radiant energy in order of wavelength and frequency.
B-oxidation
The breakdown of triglycerides into smaller subunits called free fatty acids (FFAs) to convert FFAs into acyl-CoA molecules, which then are available to enter the Krebs cycle and ultimately lead to the production of additional ATP.
Which extraction procedure will completely separate an amide from the by product of the reaction between an amine and excess carboxylic acid anhydride?
The by product of the reaction will be an acidic carboxylic acid and the excess unrelated starting material will be an acidic carboxylic acid and the excess unreacted starting material will also be acidic. Extraction with aqueous base will hydrolyze and extract both of these into the aqueous layer, leaving the neutral amide in the ether layer.
Bipolar II
The client has one or more hypomanic episodes alternating with major depressive episodes
Endomembrane
The collection of membranes inside and around a eukaryotic cell, related either through direct physical contact or by the transfer of membranous vesicles.
Tropomysin
The contraction controlled by blocking the actin binding sites of the sarcomere by Troponin Rod shaped protein; during relaxation they block the myosin binding sites so myosin heads can't bind to actin
external validity
The degree to which a study's findings have generality to other subjects, settings, and/or behaviors.
Vital capacity
The difference between minim and maximum volume of air in the lungs (TLC-RV)
A dominant autosomal allele C is required for proper development of the cones in the retina. The recessive allele c in the homozygous form results in complete color blindness. A woman who has a deutan defect is homozygous for the autosomal C allele. She marries a man who is completely color blind but carries the dominant deutan allele. What types of visual problems will their children have?
The easiest way to follow the alleles is to draw a pedigree as shown below. The symbol D represents the dominant form of the allele for the deutan trait, while the allele d represents the recessive form. In order for the trait to be expressed, the genotype must be dd in the female or d- in the male. The symbol C represents the dominant autosomal allele required for proper development of the cones. If the genotype cc is present, the individual will have complete color blindness. By examining the pedigree, we see that both children will have color vision. However, only the son will show red- green color blindness by expressing the deutan trait. The correct choice is C.
gram positive bacteria
The envelope can absorb crystal violet stain, and it will appear deep purple. The cell walls contain a thick later of peptidoglycan, a substance made from amino acids and sugars. It aids a pathogen by providing protection from a host organism's immune system. It also contains lipoteichoic acid.
triglycerides
The fatty acids in most foods and in the body occur in the form of
Primary Structure
The first level of protein structure; the specific sequence of amino acids making up a polypeptide chain.
primary structure
The first level of protein structure; the specific sequence of amino acids making up a polypeptide chain.
Prophase II
The first phase of meiosis II. Prophase II is identical to mitotic prophase, except that the number of chromosomes was reduced by half during meiosis I.
A child is rolling his toy car (with mass = m) car down a ramp. The coefficient of static friction between the car and the ramp is 0.25. When the car is halfway down the ramp, the child pushes down on the car, halting it. What is the minimum force the child must apply to keep the car from starting to roll down the ramp
The gravitational force pulling the car down the ramp is mg sin θ. To stop the car from sliding down the ramp, we must have a frictional force equal to it: Ff = mg sin θ Ff = μFN Ff = 0.25 x FN = mg sin θ The car itself has a mass m and thus generates a FN = mg cos θ The child pushing the car against the ramp surface with Fa will add to the force created by the mass of the car itself to get a total FN = mg cos θ + Fa Substituting, we get: Ff = 0.25 x (mg cos θ + Fa) = mg sin θ mg cos θ + Fa = (mg sin θ) / 0.25 Thus, the force with which the child must push down on the car is Fa = [(mg sin θ) / 0.25] - mg cos θ
Differential centrifugation
The homogenate (cell lysate) may be fractionated by differential centrifugation
euchromatin
The less condensed form of eukaryotic chromatin that is available for transcription. less post transcription
secondary structure
The localized, repetitive coiling or folding of the backbone of a protein due to hydrogen bond formation between amino acids. patterns ex. partial double bond character
Deindividuation
The loss of self-awareness and self-restraint occurring in group situations that foster arousal and anonymity.
IgG
The most abundant class of antibodies in serum transported actively against placenta
Glutamate
The most common neurotransmitter in the brain. Excitatory. Glu, E
horizontal mobility
The movement of an individual from one social position to another of the same rank.
facilitated transport
The movement of molecules across the cell membrane without the use of ATP, but with the help of a protein.
phagocytosis
The non-specific uptake of solid material by a cell accomplished by englufing the particle with plasma membrane and drawing it into the cell. ex. macrophages
anomeric carbon
The only carbon attached to two oxygens and its hydroxyl group can point down or up, giving the α (axial) or β (equatorial) anomer
Ultraviolet absorption photographs (at 260 nm) of DNA in a CsCl density-gradient solution indicate a particular DNA banding pattern. The distribution of 14N and 15N in a CsCl density gradient after two rounds of semiconservative DNA replication is represented by which of the following DNA banding patterns? (draw it)
The passage mentions that the CsCl solution is less dense near the top of the test tube and denser near the bottom of the test tube. If we were to centrifuge the DNA that was labeled exclusively with l5N, we would find that its band would appear at a lower position in the test tube compared to DNA that was exclusively labeled with 14N. This is what is represented by the control test tube (see below). If we analyze the DNA after one generation following the incorporation of 14N into the growth medium, then that DNA would be neither exclusively all heavy (15N) nor exclusively all light (l4N). Instead, the DNA would represent a hybrid of 14N and l5N DNA. The banding pattern (after analysis with ultraviolet absorption) would be intermediate between the two bands shown in the control. Note that we do not see this pattern in any of the answer choices. After two rounds of DNA replication, we find duplexes that contain the hybrid DNA (14N and l5N) and duplexes thatcontainexclusivelylightDNA(l4N).Wewouldexpecttofindtwobands:Oneintermediatebetweentheall-l4N band and the all-l5N band (characteristic of the hybrid DNA), and one that is the same as the all-I4N band on the control. There is only one answer choice that gives this pattern.
equivalence point
The point during a titration when the number of H+ ions and OH- ions are equal. This is at the middle of the steepest part of the titration curve.
axial skeleton
The portion of the skeleton that supports and protects the head, neck, and trunk
deindividuation
The process by which individuals lose their self-awareness and distinctive personality in the context of a group, which may lead them to engage in antinormative behavior.
Metaphase (mitosis)
The pulling in between the kinetochore tubules results in the chromosomes and lining up at the metaphase plate
What does evolutionary theory state when something is lost and replaced by something else?
The replacement must confer some sort of fitness to the organism
cultural capital
The set of non-monetary social factors that contribute to social mobility. symbolic and interactional resources that people use to their advantage in various situations
constant regions
The stem of the antibody monomer and lower parts of the arms of the Y. Same for a particular class of immunoglobin. These account for the 5 major classes of Immunoglobin. do not change
placenta
The structure that provides an exchange of nutrients and wastes between the fetus and mother and secretes the hormones necessary to maintain the pregnancy is HCG, estrogen and progesterone
social facilitation
The tendency to perform better when a person knows he is being watched.
disulfide bond
The three types of cross-links that form the bonds between the polypeptide chains are hydrogen bonds, salt bonds covalent interation
convection
The transfer of heat by the movement of a fluid
passive transport
The transportation of materials across a plasma membrane without using energy.
Tidal volume
The volume air inhaled or exhaled in normal breath
Inspiratory reserve volume (IRV)
The volume of additional air that can be forcibly inhaled after a normal inhalation
social cognitive theory
Theory that holds that portions of an individual's knowledge acquisition can be directly related to observing others within the context of social interactions, experiences, and outside media influences (Bandura).
The genetic code is composed of 3 nucleotides coding for each amino acid. How many possible codons exists in nature that code for the 20 amino acids found in polypeptides?
There are 4 different nucleotides (A,C,G,T) that exists in nature. Because each codon is composed of 3 nucleotides then there must exist 64 (4 to the 3rd power) possible coins for the 20 amino acids
lyase
This enzyme removes groups of atoms without hydrolysis
Fluorescence Spectroscopy
This technique can be used to quantify the amount of ethidium bromide binding to an external factor measures signal emitted from the analyte as it relaxes from an excited electronic energy level to ground state
Uncompetitive
This type of inhibitor DECREASES Km and DECREASES Vmax Binds to E-S complex (allosterically), increasing affinity (Km down), lowering Vmax (Lineweaver-Burke plot lines parallel) will work better when substrate is high
Threonine
Thr, T
derivatives of tyrosine
Thyroid homones (T3, T4) and the catecholamines (epinephrine, norepinephrine, dopamine).
telomeres
To lengthen the time that cells can replicate synths DNA before necessary genes are damaged can be slightly degraded between replication cycles without LoF
Microsatelites
Ton of our genome is made up of these § Short, simple sequences § Genetic mapping using microsatellites ú (CA)n • found ofter in 10,000 bases o amplify CA's using PCR o Number of CA specific to individual and parents • Used for forencics • Use electrophosis for paternal test
dorsal
Toward the back Being or located near, on, or toward the back or posterior part of the human body
Transcription Factors
Transcription factor binds to response elements
transduction
Transduction is the process by which DNA is transferred from one bacterium to another by a virus—in the case of the experiment performed in the passage, by the bacteriophage.
Reduction of Activation Energy Mechanism
Transition State Stabilization Microenvironment Adjustments Adjusting Substrate Proximity Transient Covalent Bonding Reactant Destablzation
viable trisomy
Trisomy 21 (Down syndrome ) trisomy 13 (Patau Syndrome) and trisomy 18 (Edwards Syndrome)
viable autosomal trisomies
Trisomy 21, 18, 13
Kleinfelter's syndrome
Trisonomy 23 male with more than one X chromosome (XXY) results in a male with male genitalia but underdeveloped testes that can not produce sperm, and some female development occurs like enlargement of breasts. T
Tryptophan
Trp, W Precursor for Serotonin and NAD
tryptophan
Trp, W non-polar
viable monosomy
Turner Syndrome (45,X) is the only _
Regulation of Oxidative Phophorylation
Two Key Regulators: 1) Limited ADP or Low O2 OP decreases and CAC is inhabited until O2 is back up 2) Abundant ADP , adequate O2 show ton ATP, CAC is activated so more NADH and FADH2 and OP increases
Watson-Crick model
Two stands of DNA are antiparallel: stands are oriented in opposite directions Sugar-phsopahte backbone is on the outside of the helix with nitrogenous bases on the inside complementary base pairing total purines= total pyrimidines
Schwann cells
Type of glia in the PNS, Supporting cells of the peripheral nervous system responsible for the formation of myelin.
Oligodendrocytes
Type of glial cell in the CNS that wrap axons in a myelin sheath.
monocistronic transcript
Type of transcription that happens in eukaryotes. Produces mRNA that carries the genetic information for the translation of a single polypeptide
Tyrosine
Tyr, Y precurssor of catecholamines
Stop Codons
UAA UAG UGA
Synthetase
Uses energy input to make a new covalent bond
centripical velocity
V= 2pir/ T
Valine
Val, V
Valine
Val, V Non polar
Best way to deliver a steroid drug to the blood stream and why?
Via injection or nasal spray. If the steroid goes down orally it may get degraded by stomach enzymes
Vitamin D mechanism
VitD synthesized as D3 in skin from UV light, or as D2 from diet. Charged as 25OH-VitD in liver. Activated by 1a-hydroxylase (regulated) in kidney to 1,25-OH-VitD. Functions are to increase Ca/PO4 to assist in bone mineralization. Does this in intestine (increases absorption of both), kidney (increases reabsorption of both), and bone (resportion of 'old' bone to mineralize the new).
kcat
Vmax/ [E] total Turnover number used to describe the rate-limintng step of catalysis under saturating conditions
Cluster A
Weird -Paranoid -Schizotypal: odd and magical -Schizoid: few interpersonal relations
glycoproteins
What does the plasma membrane of a phagocyte attach to on a microorganisms Membrane carbohydrates that are covalently bonded to proteins.
radial nerve
What nerve is associated with the following functions? • Supinate the wrist, extend the wrist and digits, extend the shoulder and elbow
complementary DNA (cDNA).
When DNA is made from RNA as the starting material, the DNA
Cholesterol and fluidity of plasma membrane
When temperatures are low, cholesterol increases fluidity by preventing the phospholipids from clumping together
paralogs
When two homologous genes are found in a single organism, these genes are termed
orthologs
When two homologous genes are found in different species, these genes are termed
operator sequence
Where a repressor can bind and block RNA Polymerase action.
Cluster B
Wild -Antisocial -Borderline: instability in mood, identify, relationships -Histrionic: needs to be center of attention -Narcissistic:needs to be loved and admired by others
metaphase of meiosis II
You are looking through a microscope at a cell in a phase of cell division. You see a double row of chromosomes lined up at the equator of the cell. -pairs of homologous chromosomes arrange themselves randomly on the equator of the spindle
% dissociation
[F-]/[HF]
sn2 reaction
a bimolecular nucleophilic substitution reaction (Primary and secondary alkyl halides undergo SN2 reactions. Although there is competition for secondary alkyl halides between SN1 and SN2. If it is a good nucleophile then in undergoes SN2, if it is an okay nucleophile such as H2O then it undergoes SN1)
Phosphodiester bond
a bond that is responsible for the polymerization of nucleic acids by linking sugars and phosphates of adjacent nucleotides not involved in stabilization of tertiary structure
acrosome
a cap that covers the sperm head
Cancer occurs when
a cell exhibits unregulated growth.
Vertical mobility
a change upward or downward in occupational status or social class
Operon
a cluster of genes transcribed as a single mRNA -regulates gene expression leels
DNA library
a collection of different cloned fragments of DNA
ternary complex
a complex of 3 molecules (ex: 1 enzyme and 2 substrate)
confounding variable
a factor other than the independent variable that might produce an effect in an experiment
spurious relationship
a false association between two variables that is actually due to the effect of some third variable
Electric Field
a field of force surrounding a charged particle E=F/q
DNA microarray
a glass slide of silicon chip where spots of single stranded DNA have been attached glass slide carrying thousands of different kinds of single-stranded DNA fragments arranged in a grid; used to detect and measure the expression of thousands of genes at one time
What does a test cross use?
a homozygous recessive individual with an unknown genotype
in order to determine the resistance of the human body
a known voltage can be applied and the current measures R=VI
In order to determine the resistance of the human body
a known voltage cn be applied and the current can be measured
spatial
a pattern that organizes a speech by the physical or directional relationship between objects or places
approach avoidance conflict
a person is both attracted to and repelled by the same goal object
Traits perspective
a personality is made up of essential stable traits that influences an individual to behave a certain way
Social facilitation
a phenomenon in which we perform simple or well-learned tasks better when in the presence of others
lateral geniculate nucleus
a place in the thalamus that receives impulses from the optic nerve
Ion paring
a salt bridge buried in the hydrophobic interior of a protein is stronger than one on the surface (no water nearby)
palmitic acid
a saturated fatty acid
symbolic ehtnicity
a specific connection to one's ethnicity in which ethnic symbols and identity remain important, even when ethnic symbols and identity remain important, even when ethnic identity does not play a significant role in everyday life
bivalent
a structure in which two pairs of homologous sister chromatids have synapsed with each other
feminist theory
a theoretical approach that looks at gender inequities in society and the way that gender structures the social world
osteoblasts
a type of cell that is responsible for bone formation high intracellular Ca
lytic cycle
a viral reproductive cycle in which copies of a virus are made within a host cell, which then bursts open, releasing new viruses
attribution theory
a way of explaining others' behavior by either one's disposition or one's situation
Secondary
a-Helicies -stabilized by H bonds side chains point away ex. Keratin B-pleated -Hbonds parallel or antibrallel ex.Fibroin
Where is ovum released upon ovulation?
abdominal cavity
spatial discrimination
ability to identify the site or pattern of stimulation
slum
abject poverty with low quality
viable
able to live
Toll-like receptors or pattern recognition receptors
able to recognize category of invader which allows for production of appropriate cytokines
If 6% of all males who are color blind have a deutan defect ( green blindness recessive) gene and 8 % of the male population is color blind, 0.4 % of incidence of color blindness in women, and incidence in men for red color blind (proton color blindness) is 2%. What percentage of female would be deutan color blind?
about 6% of all males who are color-blind have a deutan defect, which results in abnormal synthesis of the green-sensitive pigment. The percentage of females that would be deutan color-blind is (0.06) x (0.06) = 0.0036 = 0.36%. Note that the percentage of females who are protan (red-sensitive pigment defect) color-blind is (0.02) x (0.02) = 0.0004 = 0.04%. If we add 0.36% and 0.04%, we get 0.40%, the incidence of red-green color blindness among females in the United States.
Hepatic Portal System
absorb carbs and AAs
Thoracic Ductouct
absorbs Fats
ketoacidosis
accumulation of ketones (acids formed from the breakdown of free fatty acids in the absence of insulin) in the blood, associated with uncontrolled diabetes and resulting in metabolic acidosis
The Role of Acetyl-CoA
acetyl CoA is converted to Citrate to go to cytoplasm
CNS and PNS
acetylcholine
achieved status
acquired via direct, individual efforts obtained through hard work or merit
sympathetic
activated by stress secretion of adrenaline dialates pupils relaxes bronchi accelerates heartbeat sweating inhbits salivation inhibits digestion stimulates glucose production inhibits bladder contraction
Phosphofructokinase -2
activated when insulin levels are high inactivated when glucose levels ae high when activated produces Fructose 2,6 bis p This activates PFK-1 and allows override of ATP inhibition
Gq
activates phosphlipase C which cleaves a phospholipid form the membrane to form PIP2. PIP is cleaved to DAG and IP3 IP3 can open Ca channels in ER
Dopamine
activates reward circuit addiction
Controlled Processing
actively work to acquire info
homotetramer SDS-PAGE
actual wight is 4 times less
relative reactivity of COOH
acyl halides>anhydrides>Esters>Amides
T-cells
adaptive immune cells mature in thymus agents of cell-mediated immunity coordinate IS and directly kill infected cells
How are alpha and beta linkages in polysaccharides hydrolyzed
add water to break glycoside linkage
Positive punishment
adding a stimulus and have a consequence that decreases a behavior
positive reinforcement
adding a stimulus to increase a behavior
Hydroxylation
addition of hydroxyl groups to organic acceptor molecules
histone acetylase
adds acetyl group onto lysine to remove charge to loosen DNA packaging
somatic symptom
affected individual experiences pain, injury, or illness that cannot explained by medical condition ex. illness anxiety disorder -somatic symptom disorder (back pain form stress) Conversion disorder (motor or sentry symptom , linked to stress (blinds form tragic event)
Binding Proteins
affinty cure for molecule of interest
semiconservative model
after DNA replication predicted a parental DNA helix would produce two hybrid daughter DNA helices (generation 1), which would each produce a hybrid daughter DNA helix and a "new" daughter DNA helix (generation 2)
healthcare and medicine
aimed at maintain or improving the health status of the individual, family, community, and society as a whole
Immunoglobins
aka antibodies (Ig) produced by B-cells
Inducible Systems
aka positive control mechanism similar to competitive inhibition
Soma
aka. cell body location of nucleus, endoplasmic reticulum, and ribosomes
diamagnetic
all electrons are paired repelled by an external magnetic field
normal distribution
all of the measures of central tendency are the same
hypomorph
allele that has a reduced function
hypermorph
allele that has increased function variant causing increase in normal gene function
Eosinophils
allergic reactions and invasive parasitic infection upon activation release histamine results in vasodilation and increases leakiness of blood vessels
basophills
allergic responses least populousins leukocytes
glutamine
amide nitrogens do not gain or lose proofs with changes in pH
aspargine
amide nitrogens do not gain or lose protons with changes in pH
peptide hormones
amino acid polymers, chain of amino acids, they are water soluble need transport proteins to move through memembrane
pKa2
amino group~9,10
continous variables
amount of weight lost percent improvement in cardiac output
Type 1 Diabetes
an autoimmune insulin deficiency disorder caused by the destruction of pancreatic islet beta cells can't produce insluin
enzyme activity depends on
an enzyme's intrinsic catalytic efficiency, its concentration, the initial substrate concentration, the presence of inhibitors or allosteric activators, temperature, and pH.
Double approach-avoidant
an individual has two choices, both of which have good and bad points most difficult
cecum
an out pocketing that accepts fluid exiting the small intestine through the ileocecal valve and is the site of the appendix
asters
anchor the controls to cell membrane
membrane spanning domain
anchors the receptor in the cell membrane
Neuropsychological Studies
animal studes-->ablation or electrode stimulus electrode stimulus-->stimulate with electrical activity EEG--->electrodes to detect electrical activity rCBF-->detect blood flow to parts of the brain
Hypophyseal portal system
anterio pituitary is no connected physically to the hypothalthal has tow portal cystems
IgD
antibodies found on B cells and serum
Moral immunity
antibodies that dissolve and act in blood (rather than within cells)
mood disorder vs. Anxiety disorders
anxiety disorders differ from mood disorders in the fact that the underlying issue is not the individual baseline emotional state, but an irrational fear or worry which may snowball out of control
intramolecular
any force that holds together the atoms making up a molecule or compound ionic polarcovalent covalent metallic
Lewis acid
any substance that can accept a pair of electrons to form a covalent bond
Lewis base
any substance that can donate a pair of electrons to form a covalent bond
Kinetochores
appear at the centromere protein structures located on centromeres taht serve as attahment points for specific fibers of spindle apparatus (kineotochore fibers)
DNA polymerase d and e
are assisted by the PCNA protein which assembles into a trimer to form the sliding clamp The clamp helps to strengthen the interaction between these DNA polymerases and the template strand
dysfunctions
are harmful consequences of people's actions as they undermine a social system's equilibrium
DNA polymes B and e
are though to participate mostly in DNA repair
Hypothalamus
aries from diencephalon Reguation of homeotatsi emotional experience (feeding, flight, ****ing, fightingng endocrine fucintion
hydrophobic interactions
as a polypeptide folds into its functional shape, amino acids with hydrophobic (nonpolar) side chains usually end up in clusters at the core of the protein away from water
Hydrostatic pressure for liquids is linear because
as depth changes, the density of the liquid remains contant
strength
as more viability in the outcome variable is explained by variability in the study variable the relationship is more likely to be causeual
Kinesins
ass. microtubles two heads...one attached to tublin key role in aligning chromosomes during metaphor Depolymerizing microtubles durinng anaphase of mitosis bring vesicles toward the positive end of the microtuble bring vesicles of neurotransmitters to the positive end of the axonal microtubules (toward the synaptic terminal)
operationalization
assigning a precise method for measuring a term being examined for use in study
Looking-glass self
assumes that people imagine the perception others hold of them, and this perceiving of the self through the eyes of others creates the sense of self
polysynaptic reflex arc
at least one interneuron between the sensory and motor neurons ex withdrawal relax
Cross-sectional studies
attempt to categorize patients into different groups at a single point in time
Prejudice
attitude not behavior
anion-exchange
attracts negatively charged proteins (to positive beads)
temporal
auditory cortex, emotional, and language , some membory processing
Auditory pathway
auditory input-->audiotry nerve-->superior olive-->inferior colliculus-->medial genifculate nucleus--temporal cortex
diploid (2n)
autosomal copies of each chromosome
presynaptic component of the synapse
axons form synapses with dendrites of postsynaptic cell
rod shaped bacteria
baccilus
Retro-grade memory loss
back, old memory function is normal but no recollection of past events
Hindbrain
balance motor coordination, breating and digestion
Gestat principles
based on visual cues causing specific types of conceptual or visual recognition
Ion-Exchange Chromatography
beads are coated with charge substances...opoosite charge will bind to beads after all compounds have moved through...a slat gradient is used to elute the charged molecuels
Size Exclusion Chromatograpy
beads contain pores of varying sizes (tiny) smaller compounds are slowed down
proto-oncogenes
before genes are mutated
Antero-grade
before, new incapable of forming any new long-term memories.
Structural genomics
begins with the mapping of the genome and progresses ultimately to its complete sequencing
Personality Disorders
behavior that is inflexible and maladaptive ego-syntonic
Franz Gall
behvaior intellect, and personality like to brain anatormy phrenology, if a person was well developed bump would form on more developed area
Follicular phase
beings when menstrual flow begins GnRH secretion b/c decreased estrogen and progesterone hihgh GnRH increases FSH and LH FSH and LH work to develop several ovarian follicues follicules begin to produce estrogen and GnRH, LH, and FSH levels decreases
Incentive theoritsts
believe that individuals are motivated to behave in a certain way based on external forces people are drawn towards positive outcomes and pushed away from negative outcomes
Trait perspctive
believes that individual personality can be broken into countless stable traits that are ubiquitous across all humans and cultures
phenylalanine
benzyl side chain smallest aromatic
microaerophilic
best growth at low to moderate levels of 02, can grow in o2 poor niches
Advanageous
better for survival
liposome
bilayer ring of phospholipids, can contain water on the inside, slightly more stable
Affinity Chromatography
bind protein of interest once protein is retained it can be eluted by washing with a free receptor or antibody drawback is recovered substance can be bound to the elutanet
constant region of the light chain
bind tight to the constant region of the heavy chain
cyclins
bind to CDKs, creating an activated CDK-cyclin complex
Major histocompatibility complex (MHC)
bind to a pathogenic peptide (antigen) carries it to cell surface where it can recognized by cells of adaptive immune system release cytokines
Seclectins
bind to carbohydrate molecules that project form other cell surfaces weakest formed by CAMs expressed on white blood cells and endothelial cells play role in host defense....inflammation and white blood cell migration
How do steroid hormones exert their effects?
bind to receptors on the nuclear membrane (because can freely pass through plasma membrane) and bind to membranes on nucleus that deal with gene expression
Single-stranded DNA-binding protiens
bind to unraveled strand after helices pulls apart which prevents the reallocation of DNA strands and degredation of DNa by nucleases
Ligand-gated channels
binding of specific substance or ligand to open or close
clonal selection
binding with high affinity for survival providing a mechanism for generating specifity
Day 4 of fertilization
blastocysts begin to form
Diastole
blood from atria fills ventricles Semilunar valves closed causes dub in lub dub
As partial pressure of CO2 increases
blood pH decreases and respiratory rate will increases so that more carbon dioxide is exhaled, and carbon dioxide levels in blood will fall
alkalemia
blood pH is too basic respiratory rate is slowed to retain more CO2 shifting buffer equation to the right to produce more H+ ions
Systole
blood pumped out of ventricles . AV valves closed causes lub in lub dub
If plasmid self-ligates, LacZ gene is functional
blue
glycoside bond
bond between 2 monomers linked together = ossacharide
phosphodiester bond
bond used to bring two nucleotides togetehr
ligaments
bone to bone
Autosomal recessive
both M and F are affected; M-to-M transmission may be present; both parents must be carriers; the trait skips generations; two mutant alleles are needed for disease; affected children may be born of unaffected adults.
Orbitofrontal cortex
brain region associated with planning and decision making
reticular formation
brainstem regulating arousal and sleep-wake transitions
osteoclast
breakdown of bone results in release of Ca
glycogenolysis
breakdown of glycogen breakdown of glycogen to glucose
pancreatic amylase
breaks down late polysaccharides into small disaccharides and responsible of carb digestion
Anaphase II
brought by penetration of the secondary oocyte by a sperm
osteoblast
build bone
Morbidity
burden or degree of illness associated with given disease
Reaction Detablization
by creating torsional strain or hydrophobic hydrophilic reactions
Calcium Homeostasis
calcium is controlled by the thyroid and paratthyrioids parathyroids produce parathyroid hormone (PTH) negative Feedbak loop -increaes absorption form bones and GI, reduces kinky excretions of Calcium Antagonistic to calcitonin, produced by the thyroid gland -decreaes calcium absorption form GI, reabsorption in nephron. Increases bone formation
Prevalence
calculated as the number of cases of a disease per population is given period of time
1,3 bisphosphoglycerate
can be able to build ATP during substrate level phosphorylation not O2 dependent
genome
can be read in variable ways to produce different products composed of DNA or RNA in multi cellular organism different types of cells read the genome differently .
Biomedical Approach
can be treated with medication
Standard deviation
can be used to determine whether data point is outlier if falls more than three stnadard deviation form mena it is outlier
Discrimination
can differentiate between
unipotent cells
can only differentiate into one cell type
total internal reflection
can only result when a ray of light starts in a more dense medium, and then strikes a boundary going into a less dense medium (e.g. starting in water and moving out towards air). Here the light ray started in air (less dense) and moved into water (more dense) making total internal reflection impossible.
A carrier
cannot express the phenotype has a recessive allele
Mutually exclusive outcomes
cannot occur at the same time
Cytotoxic T-cells (CD8
capable of directly killing virally infected cells by injecting chemicals that promote apotheosis in infected cell MHC1 (8X1)= 8
Gas Exchange
capillaries bring deoxygenated blood from the pulmonary arteries...alveoli facilitates diffusion of CO2 from the blood into the lungs and oxygen into the blood. The oxygenated blood returns to the left atrium of the heart via pulmonary veins.
pKa
carboxyl group~ 2
Glycogen phosphorylase
catalyzes rate-limiting step in glycogen breakdown
tyrosine derived hormones
catecholamines cortisol
Bar charts
categorial data ex. ...age
Pie charts
categorial: state, ethnicites
diabetes insipidus
caused by insufficient production of the antidiuretic hormone or by the inability of the kidneys to respond appropriately to this hormone Hyposecretion of ADH causing polyuria, polydipsia, hypernatremia, weight loss, and dehydration, shock
LH (male)
causes interstitial cells to produce testosterone
Negative selection
causing apoptosis in cells that are self-reactive
G1/S checkpoint
cell determines if the DNA is in good enough condition for synthesis If there has been damage to the DNa, the cell cycle goes into arrest until the DNA has been repaired
G2/M
cell is mainly concerned with ensuring that the cell has achieved adequate size and the organelles have been properly replicated to support tow daughter cells
What do RBCs lack?
cell organelle and the ability to divide
G2 stage
cell passes through another quality control checkpoint DNA has already been duplicated, and the cell checks to ensure that there are enough organelles and cytoplasm to divide between two daughter cells The cell checks to make sure that DNA replication proceeded correctly to avoid passing on an error to daughter cells that may further replicate the error in their progeny
G0 phase
cell will enter if it does not need to divide
multipotent
cells can differentiate into several cell types
G1 stage
cells create organells for energy and protein production (mit, ribosomes, and endoplasmic reticulum, while also increasing size. governed by restriction point certain criteria, such as containg the proper complement of DNA, must be met for the cell to pass the restriction point and enter the sysntesis stage
Interferons
cells infected with viruses produce these to prevent viral replication and dispersion up regulate MHC I and II resulting in increased APC
somatic cells
cells that are not involved in sexual reproduction
G0
cells that do not divide spend of all of their time in an offshoot of G1 cell is imply living and serving its function, without any preparation for division
Golgi apparatus
cellular distribution center Golgi= UPS (a"pp" package) An organelle found in eukaryotic cells responsible for the final stages of processing proteins for release by the cell.
Metaphase
centriole pairs are now at opposite ends of the cells Kinetochore fibers interact with the fibers of the spindle apparatus to align the chromosomes at the equatorial plate each chromosome is lined up on the metaphsase plate by two spindle fibers (one form each pole)
Anaphase
centromeses split so that each chromatic has the own distinct centromoere, thus allowing the sister chromatids to separate. Sister chromatids are pulled toward the oppositie poles of cell by shrtening of kinetochore fibers
Broca's area
cerebral cortex responsible for speech production, facial control, and language processing
gases densitives
change according to the forces are applied to them. they are compressible
territorial social mobiltiy
change in locality, territory, or resistance when an individual moved from one place to antoher. common in urban than rural
Punctuated equilibrium
change occurs in rapid burst -fossils
intra-generational socialmobility
change or changes in the social status of an individual or group within the same generation. ex. 3 out of 5 brothers go to college the other 2 dropped out of high school
epigenetic alterations
change the way the genome is read by cellular machinery but do not change the genome itself
demographic shigt
changes in population makeup over time
Exponential curves
characterize populations in new environments and rebounding populations
intergenerational mobility
characterized by the change from one generation to the next
reducing agent
chemical being oxidized
oxidizing agent
chemical being reduced
fertility rate
children pe women per lifetime
birthrate
children per 1000 people per year
Prophase
chromatin condenses and becomes visible spindle apparatus appears Chromosomes become visable, nuclear envelop dissolves, spindle forms
Phropahse I
chromatin condenses into chromosome spindle apparatus forms nucleoli and nuclear membrane disappear spindile apparatus forms, and nucleoli and nucl homologous chromosomes come together and intertwine in a process called synapsis Crossing over occurs
Prophase (mitosis)
chromosome condenses, spindle forms Kinotochores appear at the centromere
Anaphase (mitosis)
chromosomes divide, 1/2 of chromosome moves to opposite side
Metaphase II
chromosomes line up on metaphase plate
lacteals
chylomicrons enter the lymphatic circulation through lacteals, which are small vessels that form the beginning of the lymphatic system
Okazaki fragments
clears additional space DNA polymerase must fill in
Type III RE
cleave at short distance from recognition site require ATP
Type I RE
cleave at sites remote from the recognition site Reggie ATP and S-adeosyl Lmethonine
Lyases
cleave portions from molecules without addition of water ex. Aldolase
Type II RE
cleave within or at short specific distances require Mg
pepsin
cleaves peptide bonds near aromatic amino
Belief perseverance
clinging to one's initial conceptions after the basis on which they were formed has been discredited
Piaget's stages
cognitive development
Stereotyping
cognitive not behavior
Observational studies
cohort studies cross-sectional studies case-control studies
Structural proteins
collagen elastin keratin actin tubulin
Sematosensory
collected by peripheral and processes
cones
color
Column Chromatography
column is filled with silica compounds move down the column size and polarity determine how fast compound moves the less polar the faster it can elute (short retention time) Used in biochem because it can collect other macromolecules such as DNA
heterochromatin
compacted chromatin during interphase appears dark under light microscopy transcriptionlaly silent
anticode
complementary to codon
Bile
composed of bile salts , pigments, and cholesterol
Recombinant DNA
composed of nucleotides form two different sources
dissociation constant Kd
concentration of hormone at which half receptors of minded (Kd): concentration of hormone at which 1/2 of the receptors are occupie
Goffman's theory of dramaturgy
concerns an individual's sense of self and self-presentation that changes depending on the situation
Asch's line experiment study of conformit
conducted an experiment to investigate the extent to which social pressure from a majority group could affect a person to conform. Asch measured the number of times each participant conformed to the majority view. On average, about one third (32%) of the participants who were placed in this situation went along and conformed to the clearly incorrect majority. In Asch's study, the research confederates participants chose a line without providing any explanation to the group.
UV Vis
conjugated pi system, increase conjugation = increase wavelength
corpus callosum
connects left and right hemispheres
cytoskeleton
connets to the connexons
social capital
considered the investments people make in their society in return for economic or collective rewards ex. social networkds
Double approach-avoidant conflicts
consist of two options with both appealing and negative characteristics
White matter
consists of axons encased in myelin sheaths
M stage (mitosis)
consists of mitosis itself with cytokinesis
grey matter
consists of unmyelinated cell bodies and dendrites
pyloric glands
contain G cells that secrete gastrin a peptide hormone
heterochromatic regions of chromosomes
contain heterochromatin and are generally not transcribed in eukaryotes
Genoic libraries
contain large fragment of DNA including both coding and noncoding regions of genomre Cannot be used to make recombinant protein or for gene therapy
funds and body
contain mostly gastric glands
antrum and pylourus
contain mostly pyloric glands
Pyrimidines
contain only one ring cytosine thymine uracil
cDNA
contain smaller fragments of DNA only include eons genes expressed by sample tissue used to make recombinant proteins or for gene therapy
Purines
contain two rings adenine and guanine
seminal vesicles
contribute fructose to nourish sperm
topoisomerases
control the degree and type of DNA supercoiling partially unwind supercoiled DNA to relieve torsional stresses that could result from "overwinding"
hypothalamus
controls are secretions that come out of the pituitary referred to as the releasing and inhabiting hormones
lagging strand
copied in a opposite direction of replication fork
Gene duplication
copying gene or genes in the DNA that are already there. If gene duplication occurs, then replication of those genes into new duplexes of DNA will give same DNA sequences, similar tRNA, mRNA, and AAs.
Mentstration
corpus letum loses simulation form LH prgesterone levels decline uterine linein is sloughed off loss high levels of estrogen and progesterine removes block on GnRH so that next cycle can begin
adrenal gland hormones
cortisol aldosterone epinephrine norepinephrine
• Drosophila knockouts
created using transposons
Smooth endoplasmic reticulum
creates lipids or fat
Homogenization
crushing, grinding, or blending tissue of interest into an evenly mixed solution
proline
cyclic amino acid amino nitrogen beomes part of side chain five membered ring limited whenre it can appear on a protein because of constraints on flexibility
Complex IV
cytochrome c oxidase cytochrome c oxidase; uses cytochromes and Cu^2+ to transfer electrons in the form of hydride ions (H^-) from cytochrome c to oxygen, forming water. Two protons are translocated by complex IV 4 ox cytochrome c molecules
dGº=
dGº=-RTlnK_eq
Necrosis
death of tissue; usually as individual cells, groups of cells, or in small, localized areas exogenous
Mortality rate
deaths per 1000 people per year
Sympathetic action on the digestive system
decrease blood flow, water reabsorption, and inhbit peristalsis
glucagon
decrease in blood sugar--> please in glucagon--> glygenolysis--> increase in blood sugar
uncompetitive inhibitor
decreases Km decreases Vm
atomic radius trend
decreases to the right since there are more attraction for electrons, which means valence shell is sucked in tighter, so radius is smaller
hypokalemia
deficient level of potassium in the blood
bile salts
derived form cholesterol important role in the mechanical digestions of fats and facilitate the chemical digestion have hydrophobic and hydrophilic regions emulsify fats and cholesterol nto micelles which increase surface area of facts which increase rate at which lipase can act
galactose
derived from lactose six carbon aldose
catecholamines
derived from tyrosine hormones secreted by the adrenal medulla that affect the sympathetic nervous system in stress response norepipherine epinephrine
ascribed status
derives from clearly identifiable characteristics, such as age, gender, and skin color. voluntary
Hill's criteria
describe the components of an observed relationship that increase the likelihood of causality in the relationship it is a correlation (relative) -temporality -strength -dose-response relationship -consistency plausibility consideration of alternate explanations experiment specificity coherence
depersonalization
detached from reality and people
Parvocellular cells
detect shape
Confidence intervals
determine range of values form sample mean and standard deviation begin with desired confidnece level (95% is standard) and use a table to find corresponding z or t score multipy z or t score by standard deviation and then add and stubtract from mean to creat value o=3 x=30 CI=95% z=1.96 3X1.96= 6 30-6=24 30+6=36 95% confident that ture mena afge is between 24 and 36
kinetic control
determines how fast thermodynamically favorable rxns occur; enzymes affect this happens at lower temperature. Takes the fastest route because it has less energy. (1,2 addition) Deny base access to the more sterically hindered alpha carbon:
smooth ER
detoxifies the cell and synthesizes steroid hormones Synthesis of lipids, phospholipids and steroid sex hormones-help detoxify drugs and poisons (liver cells).
testonesterone
develops and maintains the male reproductive system results in development of secondry sexual characteristics
Inhalation
diaphagram expands intrathoracic volume increases intrathoracic pressure decreases
exhalation
diaphragm relaxes intrathoracic volume decreases intrathoracic pressure increases
contralateral
different side
seprmatogonia
diploid stem cells
zwitter ions
dipolar ions
signal sequence domain
directed toward secretory pathway
Intensity of electromagnetic radiation
directionally proportional to the amount of photons emitted
euchromatin
dispersed chromatin appears light under light microsopy contains genetically active DNA
Motor proteins
display enzymatic activity acting as ATPases that power con. change Myosin Kinesins Dyeins
MHC class II
displayed by APC exogenous pathway because antigens originated outside the cell
Protein Purification in organic chemistry
distillation, sublimation, mixed solvent recrystilization
bimodal
distribution containing two peaks with a valley in between
Negative symptom sof schiophrenia
disturbance of affect- expression of emotion (may laugh when sad story) Abolition-decreaesd engament in goal-directed actions
Stabilization of tertiary structure
disulfide bonds h- bonds salt bridge
Mass defect
dm= nuclear mass- (mass of protons+mass of neutrons)
Prezygotic (Reproduction isolation)
do not allow formation of zygotic -breeding at different times -Living in different niches -Lack of attraction -Incompatibility of reproductive anatomy -Fertilization cannot occur
red blood cells
do not have mitochondria must produce energy anaerobically unaffected by drugs that disrupt the electron transport chain
Complex II
does not contribute to the proton gradient Succinate-CoQ oxidoreductase; uses an iron-sulfur cluster to transfer electrons from succinate to FAD, and then to CoQ, forming CoQH2. No proton pumping occurs in Complex II
alternative pathway
does not require antibodies
Bronsted Lowry acid
donates protons
Central nervous system neurotans
dopamine serotonin gaba endorphins
humoral immunity
driven by B-cells and antibodies
small intestine
duodenum , the jejunum, and ileum
tetrad
each synaptic pair contains four chromatids
Amacrine cells and Horizontal cells
edge section and contracts recieve finfo from multiple retinal cells
isoelectric point
eery molecule is now electrically neutral= to pH
Missense Mutation
effected by mutation
Hormones that are arrived from fatty acids
eicosnaoids
electrical synapses vs chemical synapses
electrical synapses use gap junction connecting two neurons and allowing ions and small molecules to pass directly between the cells. Bidirectional. Transmission is achieved by diffusion of ions across channels which is why they are faster. less regulated because they are physically connected and and this means the changes are similar in both the cells. chemical synapses us transmembrane receptors. Signals are Regenerated
which uses th?e left hand rule
electron flow
law of proximity
elements close to one another tend to be perceived as a unit
Law of Good Form
elements tend to be grouped together if they are part of a pattern which is a good gestalt
Parathyroid hormone
elevator of calcium and depressor of phosphorous responsible for elevated blood calcium
eclosion
emerging of insect from pupa
Schachter Singer theory
emotion has 3 distinct steps 1: arousal 2:interpret 3: experience emotion
Attachment
emotional bond that develops between child and caregiver
bile salts
emulsify fats
Primary
encodes folding for higher structual levels linear arrangement of AA
MHC class I
endogenous pathway binds antigens from inside the cell
macrophages
engulf and digest pathogens and signal to the rest of the immune system that there is an invader granulocyte derive from blood-borne monocytes
Claisen condensation
enolate ion of one ester acts as nucleophile attacking another ester
negative control
ensre no change in the dependent variable when no chang is expected
Positive controls
ensure a change in dependent variable when it is expected
Biopychosocial approach
environmental and lifestyle e, such as tree and socioeconomic factors interventions= medicine and/or modification to life
Enter peptidase
enzyme critical for activation of trypsinogen (pancreatic processes) activates procarbboxypeptidases A and B
Helicase
enzyme responsible for unwinding DNA generating two single stranded strands ahead of polymerase
Kinase
enzyme that catalyzes the transfer of phosphate groups from high-energy, phosphate-donating molecules to specific substrates.
PNS NT
epinephrine norepinephrine
Confounding
error during analysis
Telophase
essentially the reverse of prophase Spindle apparatus dissapears nuclear membrane reforms chromosomes uncoil Each of two new nuclei has recieved a complete copy of the genome identical to the orignal genome and to each other
FSH leads to
estrogen spermatogenesis
sweating in dry climate
evaporation of liquid pulls out heat lowers body's temperature in dry climate the low humid allows water to evaporate more and increase sweating
analogous structures
evolved independently to carry out the same function
cross-sectional designs
exams group of individuals at one time
Frontal lobe
executive function, long term planning
Oxygen Dissociation Curve
exercise is the RIGHT thing to do...aka ox offload to muscles
Crossing over
exhange equivalent pieces of DNA
self-fulfilling prophecy
expectation upon an individual rather than a group
mediating variable
explains relationship between two other variables ex. insurance coverage connects patient race and prescriptions
Suppressor or regulatory T cells
express CD4 and Foxp3 help tone down immune response once infection has been contained turn off self-reactive lymphocytes
trisomy
extra chromosome
social institutions
family education religion government and economy
Sn2
favored by aprotic solvents
Sn1
favored by protic solvents
epinephrine
fight or flight response
midpiece
filled with mitochondria generate the energy to be used as the sperm swims through the female reproductive tract to reach the ovum in the fallopian tubes
Dna polymerase d
fills in gaps left behind when RNA primers are removed
Dna polymerase b
fills in the gap in base excision repair
Nucleotide excison repair
fixes helix-deforming lesion of DNA (such as thymine dimers) via a cut and patch process that requires an excision endonuclease
Bae excision rpair
fixes non deforming lesion of the DNA helix ( such as cytosine deamination) by removing the base , leaving an apurinic/apyrimidic (AP) site and Ap endonuclease removes damaged sequence which can be filled with the correct bases
game theory
focus on the rational behavior of interacting people People are rational being who act according to their self interest
Strain theory
focuses on how anomic conditions can lead to deviance
social constructionism
focuses on how individuals put together their social reality. arise form humans communicating and working together to agree on the significance of a concept or principle. can be applied untangle concepts ; how a society defines honor and justice is dependent on the interactions and decisions of the individuals within that society subject to change as social norms and opinions over time.
Cristae
folds increase surface area located in inner membrane
longitudinal cohort design
follow group and ass at multiple intervals over a period of time
pyloric sphincter
food leave the stomach through tis
Type 2 Diabetes
form of diabetes mellitus that is gradual in onset and results from the body's deficiency in producing enough insulin or resistance to the action of insulin by the body's cells
power
form of influence over the people
london dispersion
formation of a spontaneous dipole moment that weakly attracts molecules toward each other
Glycogenesis
formation of glycogen from glucose
seprmatogeneis
formation of haploid sperm through meiosis occur in seminiferous tubles spermatogonia---> after replication of genetic material--->primary spermatocytses--->first meiotic divison--->secondary seprmatocytes--->meiois II--->spermatids--->maturation---->spermatognium
Quaternary structure
formed from multiple tertiary structures coming together and is held together through things like hydrophobic interactions, disulfide bridges, etc. It is not typically held together by an extensive network of hydrogen bonding, which characterizes secondary structure.
antrum
formed when the primary follicle develops toward the end of the follicular phase the granulose begin to secrete progesterone into antrum pressure builds up and places stress on sigma and it ruptures causing secondary oocyte and progesterone to be released into the peritoneal cavity (space outside ovary)
IgA
found in breast milk, tears, saliva, and mucous
Centromers
found in center of chromosomes composed of heterochromatin high CG During cell division two sister chromatids can therefore remain connected at the centromere until microtubules separate the chromatids during anaphase
Peroxisome
found in eukaryotes; breakdown of fatty acids, detoxification of alcohol
Cell Adhesion Molecules (CAMs)
found on the surface of most cells that aid in the binding of the cell to the ECM or other cells integral membrane proteinds -cadherins -integrins -selectins
degereneracy or redundancy
four different codons coding for the same acid it allows for mistakes
peptide synthesis proceeds in what order of terminals?
from C to N
motor neurons
from brain and spinal cord to muscles (efferent)
where does action potential travel
from dendrites and the cell body to the axon
Sensory Neurons
from receptor s to spiral for and brain (afferent)
antioncogenes
function to stop tumor progression
Vertical gene transfer
gene is based on via reproduction
Classical conditioning results
generalization discrimination extinction
hemizygous
genes on the X chromosome have only one copy
As the cell undergo mitosis, the telomeres
get progressively shorter eventually the DNA loses its telomeres and is unable to reproduce. the cell then undergoes apoptosis
Differentiation of Ectoderm
gives rise to epidermis, lens of eye, inner ear, adrenal medulla, and the nervous system (stimuli)
starvation and ketone bodies
gluconeogenis depletes the supply of oxaloacetate which is essential for the entry of acetyl-CoA in the Krebs cycle
sucrose
glucose + fructose
lactose
glucose + galactose
maltose
glucose + glucose 1--> 4 glycoside bond C1 is the anomeric carbon and is reducing
glycogen is formed by glycosidic bonds between
glucose molecule through a(1-4) linkage linearly and a(1-6) linkage at branch point
derivative of histamine
glutamic acid
Nonpolar, Non-aromatic side chains
glycine alaline, valine, leucine, isoleucin methoine proline
during periods of starvation human can generate glucose from
glycogen and glycerol portion of triagcylglyerol, and amino acids
components of cell membrane (lipid)
glycolipids steroids prostaglandin sphingolipids
Cadherins
glycoprotiens mediate calciu-dependent cell adhesion hold simple cells together sub as epithelial cells
Electric field direction
go from positive to negative
follicle cells
granulosa +thecal
prostaglandins
group of physiologically active lipid compounds having diverse hormone-like effects in animals. subclass of eicosanoids regulate cell growth and inflammation
faculatively aneaerobic
growth in o2 rich and o2 poor rch condition
Pregnancy
hCG levels high in first trimester and keep uterine lining in place 2nd trimester, hCG levels decline because placenta has grown to secret its slef
degranulation
happens when when antigen binds to antibodies on surface of mast cell
Neustress
happens when you are exposed to something stressful, but it doesn't actively or directly affect you. For example, news about a natural disaster on the other side of the world may be very stressful, but your body doesn't perceive that stress as good or bad for you so you aren't affected.
Holoenzyme
has all cofactor and coenzymes
cysteine
has an R absolute configuration because S has higher priority thiol gropu prone to oxidation
Histidine
has imidazole functional group at 2.4 one N atom is protaonated and the other isnt more acidic condition the othe rN can be protonated
Capillaries Pressure
have a slower velocity than arterial because the cross sectional area is larger because thousands of capillaries
sphigolipids
have different head groups including : phosphocoline phosphoethanolamine monosaccharide an oligosaccharide
Amphipathic molecules
have hydrophobic chains and ionic or polar ends .Surfactants are examples
Homologous structures
have similar ev. history arising from same source even though they have different functions
bivalent antibodies
have two areas each capable to binding to an antigenic determinant beneficial because antibodies can cross link antigen molecules into a large lattice as long as each antigen molecule has 3 or more determinants
medial geniculate nucleus
hearing
rod-shaped and filamentous plant viruses have a symmetry of
helical
spindle fibers
help pull apart the cell during replication and are made up of micrtubules
sperical bacteria
heterotrophic and aerobic
hypernatremia
high blood levels of sodium increased temp, weakness, disorientation, dilusions, hypotension, tachycardia. give hypotonic solution.
What frequency would you have at the oval and apex?
high frequency and low frequency respective
HDL
high-density lipoprotein; high blood levels are associated with lower incidence of coronary artery disease can only be increased by exercise or medication
glutamic acid derivative
histamine
Synapsis
homologous chromosomes come together and intertwine each chromosome consists of two sister chromatids,
major difference between meiosis and mitosis
homologous chromosomes come together and intertwine in a process called synapsis
Anaphase I
homologous pair separate and are pulled to opposite poles of the cell
Metaphase I
homologous pairs (tetrads) align at the metaphase plate , and each pair attaches to a separate sindle fiber by its kinetochore homologous chromosomes are lined up acrosss form each other at the metaphase plate and are held by one spindle fiber
Disjunction
homologus paris spearte and are pulled to opposite poles of cell each chromosome of paternal orgion separates form homologue of material orgin, and either chromosome can end up in either daughter cell Distribution of homologous chromosome t the two intermediate daughter cells is random accountts for Mendel's first law
enterogastrone
hormone that slow motility through the digestive tract slowing of motility allows increased time for digestive enzymes to act on chyme
Catecholamines
hormones secreted by the adrenal medulla that affect the sympathetic nervous system in stress response
relative mobility
how likely children are to move from their parents' place in the social hierarchy
construct validity
how the terms are defined. Degree to which a test actually measures what it claims to measure
Central nervous system
how we want to respond to sensory stimuli brain and spinal cor
hydrophilic interactions
hydrophilic molecules: (water loving) normally polar, charged molecules that are soluble in water
Michaelis-Menten kinetics
hyperbolic dependence
Graves Disease
hyperthyroidism with toxic goiter
Respiratory system when blood pH is low (academia)
hyperventilation Shift in equilibrium to generate more CO2 more CO2 blown off to drop ph to normal
Bipolar II disorder
hypomania with s least one major depressive episode
most viruses have a structure of
icosahedral
Alturism
idea of doing a good dad for someone else without any self-motive
Palindromic
identical when read backword. 5'GACGACGACGACGACGACGA3' 5'CTGGTGCTGCTGCTGCTGCT3'
B anomer
if OH on anomeric carbon is cis to OH on C6
a anomer
if OH on anomeric carbon is trans to OH on C6
Gamma decay
if a nucleus is unstable because it has excess energy, it will release that energy in the form of a photon, the photon is so energetic that it is a gamma ray
consideration of alternate explanation
if all other plausible explanations have been eliminated,t he remaining explanation is more likely
manifest function
if an action is intended to help some part of a system
experiment
if an experiment can be performed, a causal relationship can be determined conclusively
Bipolarcells
if you have a punch of different cones and rods on one you have less distingion direct input from rods/gones Synapse with ganglion cells
hyperpolarization
ihibotory input lowering MP from resting
Migration rate
immigration rate minus emigration rate
active immunity
immune system is simulated to produce antibodies
Day 7 of fertilization
implantation of blastula in uterine wall
amygdala
important for emotion and memory damage= decrease to act aggresively
Hippocampus
important for memory and learning
Cofactors
in organic Metals attatch ... metallo proteins
bidirectional replication
in some bacteria like E.coli, DNA replication involves two replication forks; these forks both start at a spot called the Origin of replication; they finish and meet eachother at the termination site At division each daughter cell receives a chromosome that is half replicated and there is a total of six replication forks
Egocentrism
inability to take the perspective o another person
Detrimental
inablilty to form functioning proteins
Zymogens
inactive enzymes... ex.trypsinogen
relative poverty
income above poverty line and below average for country
type II error
incorrectly final to reject the null hypothesis sybolised by B
competitive inhibitor
increase Km Max unchanged
Ways to increase power of an experiment
increase alpha conduct a one-tailed test increase effect size decrease random error increase sample size
What is the metabolic ATP outcome for patient experience hypoxia?
increase in glycolytic ATP production glycolysis is anaerobic and does not require oxygen to function. There will therefore be an increase int eh the rate of glycolytic to meet tissue ATP demand. Because no oxygen is avaialbe for ETC , fermentation will increase
Adjusting Substrate proximity
increase the frequency of favorable collisons
hypoventilation
increased CO2 decreased ph increased H+
After consistent aerobic exercise muscle cells increase their number of
increased number of mitochondria to supplement the amount of ATP a large amount of ATP is needed
glucagon secretion
increases amount of products in plasma increases release of free fatty acid
increased intensity of stimulus
increases frequency of firing
Aldosterone
increases salt and increases urine volume
electron affinity trend
increases to the right and up
asymptomatic period
incubation period lasts months to years, production of antibodies by the body that are detectable by blood tests.
Anomic conditons
individualism social inequality isolation erode social solidarity
social facilitation
individuals are more likely to perform better on simple task when in presence of others
Ethnocentrism
individuals compare their own cultural practices with others
functionalism
individuals fulfilling roles that meet particular social needs
Social loafing
individuals who work in a group achieve a tad exert less effort than if working alone
Granuolocytes
inflammatory reactions and allergy
automatic Processing
info gained without effort (passive)
top-down processing
information processing guided by pre-existing knowledge or expectations to construct perceptions
Competitive Inhibition
inhbitior competes with the substrate to over come saturate with substrate vMax does not change because when the concentration of substrate is higher than the inhibitor it can always compete Km changes though
Non competitive inhibition
inhbitor binds to allosteric site to change conf. so substrate can't bind inhibitor can bind when substrate is present Increasing con on noncompetitive inhibitor decreases vmax bc decreases substrate available Km does not change
Gi
inhbits adenylate cyclase which decreases levels of cAMP in cell
extranuclear pattern of inheritance
inheritance of genes located in organelles such as mitochondria. mitochondria are mostly inherited from mother
Mendel's second law( of independent assortment)
inheritance of one allele has no effect on the likelihood of inheriting certain allels for other genes.
Complex IV
inhibited by cyanide, sodium azide, carbon monoxide, and hydrogen sulfate cytochrome c oxidase; uses cytochromes and Cu^2+ to transfer electrons in the form of hydride ions (H^-) from cytochrome c to oxygen, forming water. Two protons are translocated by complex IV
sympathies division in digestion
inhibition of digestion and peristalsis
Noncompetitive Inhibition
inhibitor binds with enzyme at a site other than active site Km stays same V Max= decreases
Uncompetitive inhibition
inhibitor will only bind to enzyme substrate complex....inhibitor binds to enzyme after substrate enters so that substrate cannot release increasing inhibitor decreases vmax and Km
somatosin
inhibits production of insulin and glucagon
Somatostatin
inhibits release of insulin and glucagon
embryoblast
inner cell mass of blastocys
Intermediate filament
inside cytoskeleton. help keep shape
institutional discrimination
institutional practices that have the effect of putting a disadvantaged group at further disadvantage and remains unchanged because it does not harm powerful groups
insulator
insulator is so named because it protects, or insulates, a gene from the regulatory effects of a neighboring gene
axon hillock
integrates incoming sinals sums excitoary and inhibiroty signals
non-reducing conditions
interactions between proteins are preserved detect proteins in reduced form
Myosin
interacts with actin thick filament in myofibril responsible for power stroke involved in cellular transport
Inducer
intercepts receptor proteins to stop it from binding to operator
Viral (intracellular Pathogen) Infections
interferons are produced reduce rate of transcription and translation (reduce multiplication) fever present intracellular surface on MHCI CD8+T will recognize MHCI
hemidesmosome
intermediate filaments of the cytoskeleton that are attached to the ECM through integrin proteins
gluconeogenesis
interplays in both the cytosol and mitochondrial matrix Rate-limiting enzyme: Fructose bisphosphatase-2
internal sphinpher
involuntary control (autonomic)
Somatoform disorders
involve circumstances were the physical symptoms an individual is experiencing cannot be fully explained by a general medical condtion
variable regions of heavy and light chains
involved in antigen binding
constant region of the heavy chain
involved in cellular recognition
Dyneins
involved in sliding movement of cilia and flagella bring vesicles of waste or recycled neurotransmitters back toward he negative end of the microtubule (toward the soma) through retrograde transport bring vesicles toward the negative end of microtubule
bonds between antigen and antibody
ionic H-bond Hydrophobic
Phophofructokinase -1
irreversible
Hexokinase
irreversible enzymes in most tissues low Km (when glucose is scarce Inhibited by G6P attach phosphate to substrate (glucose) trap glucose in cell
suicide inhbition
irrevesible inhbittion
Km
is [S] such that v= 1/2 vmax
polycistronic transcript
is commonly found in bacterial operons one that contains the information to produce several different proteins
Lorentz force
is the sum of the electrostatic and magnetic forces acting on a body
Ligases
join biological molecules usually of the same type
AV node
junction of atrial travels thought the bundle of his sand to the punkinjje fibers
Catalytic efficiency
kcat/Km K2/Kcat , apparent second-order rate constant. it measures how the enzyme performs, the upper limit is 10^8-10^9
brain stabilizer
keeps neruons from out of control stabilizers
photons
lack electric charge
anomie
lack of social norms or breakdown of social bonds between an individual society
tryptophan
largest aromatic double ring contains N
Fertilization
leads to the formation of a zygote. zygote undergoes division to increase number of cells but not cytoplasmic mass. 3 days after fertilization the dividing zygote has about 16 blastomeres. At this stage the cell mass is referred to as a morula and it begins to enter the uterus. four days after fertilization a fluid, filled cavity called the blastocyst cavity or blastocoel begins to form in the central potation of th morula.As this cavity forms the cells within the morula arrange them selves into two parts outer layer= tropoblast innerlayer=embryoblast trophoblast give rise to the placenta while the embryo blast give rise to the embryo around the sixth day after fertilization the blastocyst attach to the uterine
Reception learning
learning that comes from instruction This form of learning requires the ability to receive and process structured information as received by the teacher. In order for this to effective, teacher presentations should be organized from general to specific and should use a variety of organizational tools.
Lateriality
left brain dominant analytica langeuate logic math left-side hearing right side emotion creativy inturition
Visual Pathways
left visual field will go to right side of the brain and vice versa temporal fibers ...opitkc chaism--->LGN-->superior colliculus_-->visual cortex (occiptal lobe)
Z-DNA
left-handed helix that has a turn every 4.6nm and contains 12 bases within each form
Menospase
less sensitive to FSH LH, resulting in ovarian atrophy
Persistent Depressive Disorder
less severe and longer duration
pupil
lets light in ..constricts in light. ...dilates in dark
Neutrophils
leukocyte phagocytic granulocyte follows bacteria using chemotaxis can detect bacteria once they have been opsonized
corona radiata
lies outside the zone pellucida and is a layer of cells that adhered to the oocyte during ovulation
nicotinic Ach
ligand gated ion channels nAchR are located at the neuromuscular junction on the postsynaptic side Activated by Ach on the synapse The diffusion of Na+ and K+ across the receptor causes depolarization, the end-plate potential, that opens voltage-gated sodium channels, which allows for firing of the action potential and potentially muscular contraction. Fast excitatory postsynaptic potential (EPSP)--b/c directly gate inotropic receptors--> net flow of (+) ions--> fast depolarization [ms]
p-value
likelihood statistic was obtained by random change compared to significance level (a)= 0.005 if p-vlue is greater than a the we fial to reject the null hypothesis, which means that there is not a statistically significant diference between the tow population If p-value is less than a then we reject the null hypothesis and state that there is a staticially significant difference btween groups
type I error
likelihood we report a diffence between two poputlation when one does not actually eist
Ependymal cells
line the ventricles of the brain and produce cerebrospinal fluid
sp
linear 180º
regression analysis
linear, parabolic, exponential
peritoneal sac
lines the abdominal cavity
Interneurons
linked to reflexive behavior
prostaglandins
lipids that can act as hormones and hormones are secreted into the circulatory system
microvilli
live the small intestine
Glycogen is stored in the
liver
first order
ln[A] = -Kt + ln[A] A process that depends on the concentration at any one time , most drugs have first order elimination kinetics . If an enzyme system responsible for drug metabolism becomes saturated than the elimination kinetics change to zero order . The rate if elimination proceeds at the sane rate and is unaffected by an increased concentration of drug eg alcohol, phenytoin . . For an enzyme-catalyzed reaction with a very low initial substrate concentration, and where Km >> [S], the Michaelis-Menten equation may be approximated as V = Vmax [S] / Km, where Vmax / Km is a constant of the reaction. Under these conditions, the reaction is approximately first order with respect to S.
thoracic duct
located at the base of the neck enter the venous circulation
acing cells
located in pancreas produces pancreatic juices bicarbonate rich alkaline
delta cells
located in periphery of islets, secretes somatostatin
B-cells
located in spleen turn into plasma cells to produce antibodies as part of adaptive immunity considered naive when they leave the bone marrow and mature when exposed to antibodies
metaphysis
longitudinal the flared portion of a long bone, between the diaphysis (shaft) and the epiphyseal plate
diabetes insipidus
low ADH causes you to have FVD, dilute urine and concentrated blood. You're worried about shock. excessive urination but no sugar
generalizabilty (external validity)
low= narrow conditions for sample section do not reflect target population= diagnosed with the last year high= representative of target population= distribution of tie since diagnosis that is similar to the population of all psoriatic patients
non-competitive inhibitor
lower Vmax Km unchanged
vacuum distillation
lowers the boiling points of the substances to be distilled
Lacteals
lymphatic vessels located in small instestinge Fats, package into chylomicrons by intestinal cells, enter the acetal for transport
Agranulocytes
lymphocytes monocytes macrophages
Immunity
lympnoes are a place for APC and lymphogties to interact
immune function of lungs
lysozyme internal airways are lined with mucous, which traps particulate matter and larger invaders macrophages mast cells
Transcription
mRNA binds to tRNA to go to 3' to 5' direction...will keep going until it finds a start codon (peptide tRNA) large subunit (initiator) will carry on methionine and will bind Psite to start codon aminoasyl tRNA will bind to the A site GTP is released Elongation: pepitide bond goes between two initiator tuna and the former protein is released (E-site)and the ribosome will shift down What was in the A site shifts over to the P-site ..only initiator tuna can bind directly to P....goes until stop codon release factors tell ribosome to let go
protein levels are most directly related to
mRNA levels
osteoclasts
macrophage in bone
Langerhans cells
macrophage in skin
microglia
macrophage in the CNS
Chromatin
made form histones
Glucagon
made in Alpha cells
Insulin
made in B cells increase in sugar--> release insulin--> increase in PFK 2---> glucose uptake by tissues (converted to glycogen and used for fatty acids or proteins)---> decrease in blood sugar
Somatostain
made in Delta cells
p53
main protein in control of cell damage repair
ribosome
main site needed to run through translation
microtubles
maintaining cell shape
Tubulin
make up microtubules polarity negative side= adjacent to nucleus positive side= periphery of cell
Strecker synthesis
makes an aldehyde + NH4 + Cl- + KCN into amino acid
Actin
makes up microfilaments and thin filaments in myofibrils most abundant protein in eukaryotic cells positive side and negative side polarity= allows motor protein to travel unidirectionally along actin filament
positive selection
maturing only cells that respond to the presentation of antigen of MHC
Total lung capacity (TLC)
maximum volume of air in lungs when one inhales completly
positively skewed distribuion
mean higher than median
negatively skewed distribion
mean lower than median
standard distribution
mean of zero STD of 1..newly generated curve
Helmholtz
measured speed of a nerve impusle
non-disjunction
meiosis in which there is a failure of paired homologous chromosomes to separate
tryptophan derived hormones
melatonin, serotonin
tight junctions
membranes of neighboring cells are actually fused forming continuous belts around cell to prevent leakage of extracellular fluid
explicit
memories that require conscious recall
Implicit memory
memory a person is not aware of possessing
implicit memory
memory a person is not aware of possessing
procedural memory
memory for skills, including perceptual, motor, and cognitive skills required to complete tasks ex: riding a bike
semantic memory
memory of ideas, rules, words, and general concepts about the world
Semantic memory
memory related to facts
spreading activation
memory storage
X-ray crystallography
mesaure electron density used for Nucleic acids and proteins
Fn is equal to
mgcos + ma(if something pushing)
Normal Force
mgcos or mgcos+ma
Centrioles
microtubule organizing centers
phagosome fusion with lysosome
microtubules
MJ
million joules
monosomy
missing a chromosome
dissociative amnesia
missing memories of past due to traum
Allosteric Enzymes
molecule binding is an inhbitor
homotropic regulation
molecule serves as a substrate for its target enzyme as well as a regulatory molecule of the enzyme's activity ex. O2 is a homotropic allosteric modulator of hemoglobin
Activity analysis
monitoring known reaction with given concentration of substrate and comparing to standard
serotonin
mood, sleep, eating and reaming
Kohlberg's stages
moral reasoning addressing how people reason
thermodynamic control
more stable high temp
spiral bacteria
motile bacteria having a helical or spiral shape, elongated ex lyme disease
magnocellular cells
motion
Parkinson's Disease
movement disorders decreased dopamine production Managed with L-DOPA
veritcal mobility
moving up or down the social ladder within a person's last time ex. Lauren starts off at an entry-level postion at an accounting firma nd moves up to senior VP level within 20 years
skeletal muscle cells
multinucleate Voluntary muscle cells; you control when they move. They are specialised cells.
temporal summation
multiple signals are integrated ruing a relatively short time a number of small excitory siganls firing at nearly the same moment could bring a postsynaptic cell tothershold, enabling an action potential
tendons
muscle to muslce
carbohydrate digestion
must be broken down into monosaccharides for absorption
Oncogenes
mutated genes that cause cancer encode cell cycle-related proteins
Frameshift mutation
mutation that shifts the "reading" frame of the genetic message by inserting or deleting a nucleotide
three ways that ATP-dependent chromatin remodeling complexes may change chromatin structure
mutations can occur during chromatin remodeling - can cause a long stretch of DNA - remodelers may evict histones from DNA and cause gaps where nucleosomes are not present - changes in compositions of nucleosomes by removing standard histones and replacing them with histone variants
strength of magnetic field
mv/qr
Thick filaments
myosin A band
Breathing pathway
narse (nose)--> pharynx--> larynx-->trachea-->bronchi--->bronchioles-->alveoli
lysozyme
nasal cavity contains this enzyme that is able to attack walls of gram positive bacteria
Coenzymes
necessary for protein function BC are water soluble when bound super tightly called a prosthetic group
hydrogen bonding interactions
needs a hydrogen and FOH
Distress
negative type of stress that builds over time and is bad for your body. It happens when you perceive a situation to be threatening to you some way (physically or emotionally) and your body becomes primed to respond to the threat.
Neustress
neutral stress; the arousal it causes doesn't help or harm the body
granulocytes
neutrophils,eosinophils,and basophils
nuleotides
nitrogenous base, five carbon sugar, at least one phosphate group ex...GTP
nucleoside
nitrogenous base, five-carbon sugar
X-linked recessive
no M-to-M transmission, and mother is usually an unaffected carrier
absolute refractory period
no amount of stimulation can cause another action potential to occur
Silent Mutation
no change
reverse transcriptase enzyme
no exonuclease activity therefore it is more prone to making mistakes This leads to high rate of mutation when HIV replicates replicates RNA genome
strictly aerobic
no growth in 02 poor condition
strictly anaerobic
no growth in 02 rich condition
non-ionizing radiation
no known genetic damages, modalities (US, MRI)
Cultural capital
non-financial social asset that helps improve an individual's position/status in society
Hydrophobic
non-spontanoeus
smooth muscle
non-striated and under involuntary control uni-nucleated
symbolic culture
nonmaterial culture ex. mottos, songs, catch phrases
Natural killer cells (NK)
nonspecific lymphocyte detect down regulation of MHC and induce apoptosis in virally infected cells
medullary collecting duct
not collecting anymore, filtrate reabs, more water before being urine, vasopressin (ATH) acts here which then changes osmolarity highest concentration
activator
not increase [substrate] required to reach Vmax
confounding variable
not of interest to researcher but is extraneous variable which is related to both dependent and independent variables
chromatin
not visible with light microscopy during interphase
Astrocytes
nourish neurons and form the blood-brain barrier
Bacterial artificial chromosomes (BACs)
nserts can be up to 300,000 bp long
Prophase II
nuclear envelope dissolves, nuclei disappear the centrioles migrate to opposite poles, and the spindle apparatus begins to form
Telophase I
nuclear membrane forms around each new nucleus chromosome still consists of two sister chromatids joined at centromere cells are haploid; n chromosomes found in eahc daugheter cell
Telophase II
nuclear membrane forms around each new nucleus cytokinesis follows, and two daughter cells are formed up to four haploid duaghters cells are produced per gametocyte
Dna polymerase a
nuclear, DNA replication, no proofreadin
Polynucleotides
nucleic acid biopolymers are composed on nucleotide monomers
Frameshift
nucleotide is completely removed, genetic sequence will be shifted -a one base pair deletion/inserstion
highly conserved
nucleotide sequences which have not changed significantly over long stretches of evolutionary time. if there is a mutation it will adversely affect the organism
incidence
number of new cases of a disease per population at risk in given period of time...ex. new cases per 100 at reisk
Nonsense mutations
o Change a normal codon to a STOP codon Mutations may also involve the addition or deletion of one of more bases of DNA
• Missense mutations
o Do alter the amino acid sequence ß Gluc 6 Val of beta-globin in Sikle-cell anemia ˙ Single base pari change from glutatmic acid to a valine ß Nutral mutation is conscrved ˙ New amino acid has no detectable • Don't change much to the protein structure
nonmalefience
obligation to avoid treatment or tintervention in which the potential harm outweighs the potential for benefit
cross-linking of cysteine residues in polypeptides
occurs inside the cell due to reducing environments of the cytoplasm
cooperativity
occurs when enzyme's binding of one substrate increases or decreases the affinity of the enzyme for another substrate. Thus cooperatively requires multiple binding sites on enzyme
Melting point graph
occurs when fraction is 50%
Minority influence
occurs when opinion minorities persuade others of their views influence of new ideas
sp3d2
octahedral 90º
Opsonization
once bound to specific antigen, antibodies may attract other leukocytes to phagocytize the antigens immediately
haploid
one copy of each chromosome
Relative poverty
one i poor in comparison to a larger population
moderator variable
one that includes the strength of a relationship between two other variables ex. social status vs self-exam mv= age
mediating variable
one which explains the relationship between two other variables.
confounding variable
one which is not typically of interest to the researcher but is an extraneous variable which is related to BOTH the dependent and independent variables.
Single-blind experiment
only the patient or assure is blinded
I band
only thin filaments
glottis
opening of the larynx covered by the epiglottis during swallowing
anus
opening through which waste are eliminated and consists of tow sphincters: the internal and external anal sphincters
Digestion pathway
oral cavity-->pharynx-->esophagus-->stomach-->small intestine-->large intestine --->anus
Arteries
oxygenated except pulmonary and umbilical muscular and elastic recoil elastic recoil drives high pressure
Golgi apparatus
packages and deliver cellular material for transport
endophrins
pain keillers
Glucagon is released by the
pancreas
Alpha cells
pancreas produce glucagon?
Stereotype threat
paradoxical effect where if one group is aware of a negative stereotype of negative stereotype they are more likely to conform to that sterotype
Facilitated diffusion
passive transprot diffusion of molecules down a concentration gradient through a pore in the membrane created by this trasmembrane protein used for molecules that are impermeable to membrane
Urbanization
pattern of movement from rural areas to cities. In this scenario, the rural town of Ohen does not have enough resources to support this population, so the people are moving to Benin City, a classic example of urbanization.
X-linked dominant
pedigree where affected offspring have affected parent, affected males pass trait to all their daughters but none of their sons, affected females pass trait to 50% of their sons and daughters
absolutie powerty
people do not have enough resources to acquire basic life necessities, such as shelter, food, clothing, and water
oxytocin is what type of hormone?
peptide hormone
oxytocin
peptide hormone A hormone released by the posterior pituitary that stimulates uterine contractions during childbirth and milk ejection during breastfeeding.
Insulin
peptide hormone contains alpha helices
Secretin
peptide hormone that causes pancreatic enzymes to be released into the duodenum regulates pH of digestive tract by reducing Hcl secretion from parietal cells increases bicarbonate secretion from pancreas an enterogastrone
Lateral Genictualte Nucleus
perceives light coming in part of thalamus (relay station that diret it to where it needs to go
Law of Figure/Ground
perception needed to distinguish object from background (lamp vs 2 people's faces)
General anxiety disorder
persistent worry about many things ex. mortgage payments
Behaviorist perspective
personality is a result of learned behavior patterns based on a person's environment
Proton-Motive Force
ph decrease and voltage difference increases The proton concentration gradient across the inner mitochondrial membrane that is created in the electron transport chain and used in oxidative phosphorylation.
enzymes can alter
ph, substrate shape
microglia
phagocytic cells that ingest and break down waste products and pathogenst
hyperchromism
phenomenon that happens in DNA when the both strand are separated (melted) increase in absorbance
maternal effect
phenotype of the offspring is determined by the nuclear DNA of the mother. Genes are inherited from both parents but the child doesnt show dad's phenotype. Happens in cytoplasm of the egg when mother deoposits gene products into the cytoplasm of the egg in early development
phenotypic results of individual with XXX
phentypic disorders will be mild since the extra X chromosome will be inactivated
Covalently modified enzymes
phosphate group activates/deactivates enzymes
phosphatides
phospholipid
components of emotion
physiological arousal expressive displays subjective experiences (how you feel and interpret emotions)
cross sectional area
pi X r^2
bilrubin
pigment in bile if liver is unable to process or excrete bilirubin, jaundice or yellowing of the skin may occur
Thrombocytes
platelets cell fragments released from the bone marrow Assist in closing the blood
glial cells (neuroglia)
play structural and supportive roles
Chiasma
point of synapsis
serine
polar
threonine
polar
tyrosine
polar aromatic
Nucleic Acids
polymers with nucleotides being repeated
just notable difference
porportional take change and divideit by the intial stimulus ex. 5, 4 4 is initial .....1/4= 25% and 10, 9 9 is inital tf 1/9 1/9 < 1/4 and 1/4 is the threshold therfore 1/9 is below the threshold
Sigmoidal Curves
positive cooperativity can be recognized it Allosteric activation v. Allosteric inhibition
arginine
positively charged
lysine
positively charged
Hawthorne effect, observation bias
posits that the behavior of the study participants is later simply because they recognize that they are being studied
Cerebellum
posture, balance, body movements inhbited by alcohol
azide
powerful nucleophile
Oogenesis
prdouction of female gametes primary oocytes (2n)---> menarche---->secondary oocyte +polar body
mast cells
preformed antibodies on surface when substance attaches to antibody, inflammatory chemicals are released release histamine
natural immunity
present in the individual at birth, prior to exposure to a pathogen or antigen, and that includes intact skin, salivary enzymes, neutrophils, natural killer cells, and complement.
Telomere
prevents losing sequences and information during replication by adding a repeating unit at the end of DNA
IgM
primary immune response
Striate cortex
primary visual cortex
Goffman back stage
private areas of our lives where we do not have to act but be our true selves
power
probability of correctly rejecting a false null hypothesis =1-b
autoradiography
process used to detect the amount and location of bound can be used during S phase
granulosa cells
produce estrogen immediately surround the oocyte
bulbouretheral (Cowper's) glands
produced a clear viscous fluid that cleans out any remants of urine and lubricates the uretra duruing arosal
Myelin is produced where in CNS and PNS?
produced by oligodendrocytes in central nervous system produced by Schwann cells in the peripheral nervous system
Epinephrine
produced by the adrenal medulla stimulated by the sympathetic nervous system promotes glycogeneolysis and fatty acid release from adipose tissue
Thyroxine
produced by the thyroid gland Stimulated by TSH Promotes glycogenolysis and sugar absorption by intestines
Telophase II
produces a zygote and a second polar body
Thyroid gland
produces calcitonin in para cells calcitonin decreases blood calcium levels by inducing osteoblasts
Adrenal Cortex
produces cortiosl and sex hormones
Pituitary gland
produces: FSH and LH
LH leads to
progesterone testosterone, essential for meals development
Which hormones primarily act on the endometrium?
progesterone and estradiol
proactive
promote social change
Penetrance
promotion of individuals in population with a genotype who actually express phenotype ex.3 affected 2 normal....3/5= 60%
derivatives of arachidonic acid
prostaglandins, leukotrienes, thromboxanes
zona pellucida
protect the oocyte and necessary for sperm cell binding
Troponin
protein present in skeletal and cardiac myocytes that bind Ca in order to expose biding sites on actin filament for myosin to bind to, initiating contraction
Histones
proteins contain basic functional groups that give them a net positive charge at body pH which encourages interaction with negatively charged phosphate groups on DNA
complement sytem
proteins in blood that act as nonspecific defense against bacteria by punch holes in bacteria making them unstable
nucloproteins
proteins that associate with DNA most are acid-soluble and tend to stimulate transcription
Ion channels
proteins that create specific pathways for charged molecules
Polyacrylamide gel
proteins travel through based on size and charge small move faster highly charged move faster large electric field move faster slower -bigger -more convluted -electrically neutral
schizophrenia
prototypic l psychotic disorder positie symptoms: behavior thoughts or feeling added to normal behavior negative sysmptorms: absence of normal or desired behavior Medication are for positive
glycolipids
provide energy and serve as markers for cellular recognition
boiling chips
provide nucleation sites that give the liquid a place to start forming bubbles to prevent super-heating
lymph nodes
provide place for immune cells to communicant B-cells can be activated here
cell-mediated immunity
provided by T-cels
Network support
providing a sense of belonging to a person
moderating variable
qualify a causal relationship as dependent on another variable; impact of anxiety on memory depends on level of fatigue
what structure is a dipeptide
quaternary because has two or more polypeptide chains to form
Magnetic Force
qv x Bsin
Ionizing radiation
radiation w/enough energy to free electrons from atoms forming ions, may cause cancer (ex. gamma, X-rays, UV).
depolarization
raising membrane potential from resting
Brownian motion
random movement of molecules in a fluid or gas power background thermal energy
absolute mobility
rapid economic growth, every bodies standard of living increases
isocitrate dehydrgenase
ratelimintng step 1st NADH produced form acetyl-CoA
Zero order
reactant concentration independent, Rate = k see a linear decrease in the plasma concentration of a substance The reaction would display zero-order kinetics only if increasing substrate concentrations did not lead to an increase in the reaction velocity. This is generally true under saturating conditions, when substrate concentration is high relative to Km and when V = Vmax.
Draw Lactate reacting with NAD+
reagent is lactate dehydrogenate NADH has a strong absorbance at 350 NAD+ does not
annealing
reassociation of separated strands
inferior colliculus
receives auditor sensory information
superior colliculus
receives visual sensory input
ADH
reduces plasma osmaolarity
function
refer to beneficial consequence of people's actions
second sickness
refers to an exacerbation of health outcomes caused by social injustice
mortality
refers to deaths caused by a given disease
Goffman first stages
refers to interactions with society in which an individual knows behavior will be judged
appraisal
refers to stress stimulus
External validity
refers to the generalizability of the research to settings beyond this study. an experimental setup that closely resembles real-life situations so that results can safely be generalized to such situations
H zone
region containing thick filaments only
Secondary structure
regularly-occurring structure in proteins and is primarily formed through hydrogen bonds between backbone atoms.
ventilation
regulated by medulla oblongata
Voltage-gated channels
regulated by membrane potential change near channel
medulla oblongata
regulates breathing heartbeat, and blood pressure
Variable interval schedule
reinforced after an unknown or unpredictable amount of time has elapsed
variable ratio schedule
reinforced after an unknown or unpredictable number of responses ex. gambling for reinforcement
Continuous reinforcement
reinforcing the desired response every time it occurs
Feature detection
related exclusively to vision, not smell
Reconstructive bias
related to memory such that it is not as accurate as we think
intermolecular
relatively weak interactions that occur between molecules Dipole dipole hbond london dispersion
Pons
relays information and regulates sleep ...sleeps pon the bed
Cortisol
released by the adrenal cortex glucocoridcoid Stimulated by ACTH from the anterior pituitary enhances gluconeogenesis and antagonizes insulin
LH
released by the anterior pituitary and causes ovulation. Simulated by an increase in estrogen
brush-border enzymes
released when chyme is in the duodenum ie. disaccharides and peptidases present on luminal surface lining and break down dimers and trimers of biomolecules into absorblale monomorers
Adrenal Medulla
releases epinephrine and norephrin
DNA gyrase (DNA topiosomeras II)
releives supercoiling by introducing negative sup coils works ahead of helloes, nicely both strands passing the DNA strands through the nick, and then resealing both strands
negative punishment
removing a stimulus to decrease a behavior
negative reinforcement
removing a stimulus to increase a behavior
Weak bonds permit
repeated interactions
telomerase
replases lost sequence at the end of each round of replication high GC content
DNA polymerase y
replicates mitochondrial DNA
DNA polymerase III
replication proof reading and editing 3--5'
log-log graph
represent fold change
Cycindependent Kinases (CDK)
require the presence of the right cyclins during the cell cycle, concentrations of various cyclins increase and decrease during stages
primers in PCR
requires 2 primers that are complementary to the 3' ends of the sense and anti-sense strands
classical pathway
requires the finding of an antibody to a pathogen
reactive
resist change
• Homologous recombinants are identified
resistance to certain drug
hyperventilation
respiratory alkalosis increased pH decreased H+
gastric glands
respond to signals from the vagus nerve of the parasympathetic nervous system
justice
responsibilty to treat similar patients with similar care and to distribute health care resources fairly ex. transplant given to young child instead of elderly adult large population will generally have more good than small population ethncity, sexual orientation, financial status are not morally relevant differences religion may or may not be a valid moral criterion
estrogen
responsible for initial thickening of endometrium
thymosin
responsible for maturation of T-cells
DNA polymerases
responsible for reading the DNA template and synthesizing the new daughter strand read template in 3' to 5' direction while syntesizing complememntary strand in 5' to 3' direction
centrosome
responsible for the correct division of DNA
VLDL
responsible for the transport of fatty acids synthesized de novo in the liver primary vehicle for carrying liver-synthesized triglyceride lips must first reach liver for synthesis to occur
autonomy
responsible to respect patients decision and chosces about own health ccare
repolariztion
restoration of the negative membrane potential
Detection bias
results from educated professionals using their knowledge in an inconstant way for diabetes study a doctor might screen for more overweight patients than healthy
Meiosis I (reductional division)
results in homologous chromosome s being spirited generationg hapolid daughers
Meiosis II (equational division
results in separation of sister chromatids
Mitosis
results in two diploaid daughers
pluripotent cells
s (such as embryonic stem cells) can differentiate into almost every cell, but can't give rise to an entire, intact individual
dose-response relationship
s the study or independent variable increases, there is a proportional increase in the response. The more consistent this relationship, the more likely it is to be causal
mRNA
same as complement but with a u
Ipsitaleral
same side
ventromedial hypothalmus
satiety center you are full now
which nutrient has the greatest heat of combustion?
saturated fats because more highly reduced
H1
seals off DNA as it enters and leaves the nucleosome adding stability to the structure
Seasonal Affective disorder
seasonal consent Symptoms-> present in winter months, abnormal melatonin metabolic, bright light
Meiosis I (females)
secondary oocyte (gamete) and polar body
parietal cells
secrete H+ once cleaved pepsinogen to pepsin secrete intrinsic factor
Helper T-cells (CD4+ Tcells)
secrete lymphokines recite other immune cells loss of these occur in HIV CD XMHC=8 repson to MHC II (3 X2=8)
Gamma cells
secrete pancreatic polypeptide which reduces appetite
chief cells
secrete pepsinogen
interstitial cells of Leydig
secrete testosterone and other androgens
Gastrin
secreted by G cells induces partial cells to secrete more Hal and signals the stomach to contract, mixing its contents
progesterone
secreted by corpus luteum in response to LH involved in develoopment and maintenc of endometrium
intrinsic factor
secreted by parietal cells involved in absorption of vitamin B12.
enteropeptidase
secreted by the duodenum
progesterone
secreted by the ovary and corpus lute and maintains the prelacy by inhibiting the loss of the endometrial lining
cholecystokinin (CCK)
secreted in response to the entry of chymeinto the duodenum
endocrine system is composed of
secretes hormones directly into the bloodstream and is composed of the following glands: hypothalamus of the brain anterior and postiuitary pituitary gland thyroid and parathyroid medulla and cortex of adrenal islets of lagerhands in the pancreas pineal gland ovaries and testes
duodenum
secrets enteropetidase CCK into bloodstream and secretin
Duplication
section of DNA is duplicated
cocci bacteria
seen forming chains in this urine sample
Insertion
segment of dan is moved to a different chromosome
Translocation
segments of DNA are exchanged
IgE
sensitizes cells to allergens
Vestibule
sensitve to linear acceleration ...up and down affects balance and orientation in space
Midbrain
sensorimotor reflexes
Semicular canals
senstitive to rotational accelation
DNA helicase
separate double-stranded DNA into single strands allowing each strand to be copied
Electrophoresis
separated by charge and size negatively charged compounds will migrate towards positively charged anode positvely chareged compounds will migrate toward negatively charged cathod
SDS-PAGE
separates based on mass SDS disrupts noncovalent interaction by neutralizing protiens original charge and denaturing the protein
Bicuspid
separates left atrium (lab)
tricuspid
separates right atrium (rat)
Isoelectirc Focusing
separating by pI positively charged migrate toward cathode negatively charge toward anode as protien reaches the portion of gel where pH is equal to the protein's pI, the protein takes on neutral charge and will stop moving
cytokinesis
separation of cytoplasm and organelles
Meiosis I
seperates homologous chromoses to create haploid daughter cells two haploaid daugher cells each with 23 chromosomes consisting of 2 sister chromatids per chromosonmes (for females)
Meiosis II
seperates sister chromatids to create two haploid cells
polar amino acids
serine, threonine, asparagine, glutamine, and cysteine
derivatives of tryptophan
serotonin and melatonine
kinetochore fibers
serve as attachment points for specific fibers of the spindle apparatus
gametes
sex cells
sex pili
sexual-like structure that can join 2 bacteria to exchange DNA
diaphysis
shaft of a long bone
Fetal Hemobglobin
shift left to yank ox from mom
Fetal Hemoglobin
shift to left (HbF) 2,3 BPG does not bind well to HbF decrease in Cow, H+, Temp, and 2,3 BPG
interkiniesis
short rest period after telophase I chromosome partially uncoil
Reannealing
signle starnded DNA to doublestranded DNA if denaturing condition is slowly removed
single-crossover vs double cross over
sing: affect only the ends of chromosome arms double: effect segments in middle of chromosome arms only occur during meiosis
Capillaries
single cell layer thick Allow diffusion of O2 and Co2, glucose, ammonia, urea
monosynaptic reflex arc
single synapse between sensory motor neuron ex. knee jerk relex
Meiosis II (males)
sister chromatids are split into 4 gametes
nucleoulus
site of cellular rRNA transcription and processing of ribosome assembly
implicit
skils and conditinoned response
Histones
small basic proteins that make up a chromosome
Smell
smell goes straight to processing does not go through thalamus
Tangible support
social support focused on practical or material needs
meritocracy
society in which advancement up social ladder is based on intellectual talent andachievment
peripheral
somatic and autonomic
Characteristics of Enzymes
some change shape after binding created catalytic effect than lab catalyst break bonds in substrate and make the bonds in product
sound waves and molecular collisions
sound is a mechanical wave, and so it lies on molecular collisions for propagation. For this reason, sound travels fastest in solids where molecules are closer together
ATP Synthase
spans inner membrane, protrudes into the matrix
Parietal
spatical processing..where we are
lacteals
specialized lymph vessels in the small intestine that absorb fat into the bloodstream
demographic transiton
specific example of demographic shift referring to changes in birth and death rates in a country as it develops from a preindustrial to industrial system stage 1) preindustrial= birth and death rates high stage 2) improvements in sanitation and health cause death to drop Stage 3) improv. in contraception and right cause decrease in both rates Stage 4) industrialized society; birth and death rates are both low
ghettoes
specific racial ethnic minorities are concentrated, usually due to social or economic inequities`
mediating variable
specifies a given cause that works indirectly through a more direct cause to a final effect adds variance a variable that "comes between" two other variables in a causal chain. variable helps to explain part or all of the relationship between two other variables (A+B+C)
laminar flow speed
speed will be greatest in the middle and approach zero at the walls fo the tube
Seminiferous tubules
sperm is produced here
Hypdrphilic
spontaneous
case-control studies
start by identifying the number of subjects with or without a particular outcome and then look backwards to assess who many subjects in each group had exposure to a particular risk factor e.x 100 patients with lung caner and 100 patients without lung cancer are assessed for their smoking history
B-cell activation
starts off as naive B-cell--> particular antigen--> proliferation-->primary response-->if same microbe is encountered again--->secondary response
BLAST
starts with a genetic sequence and then locates homologous sequences in a large database • BLAST will search the entire database selected and determine which sequences are the closest matches
categorial variables
state status
gas liquid chromatography
stationary phase is a liquid that is immobilized on a solid. detention of sample constituents involves equilibria between a gaseous and a liquid phase
• totipotent
stem cells can give rise to all cell types
Cortisol
steroid hormone produced by the adrenal cortex. inhibits immune system, increasing blood glucose and necessary when dealing with stress
Aldosterone
steroid hormone: derivative cholesterol made by the adrenal cortex response to decrease in blood volume immediate effect: reabsorbs more salt by increasing Na/K pump in the nephron effect on osmolarity and volume: increases blood volume
ligan-binding domain
stimulated by ligand and induces conf. change that activates catalytic domain results in second messenger cascade
FSH (male)
stimulates the Sertoli cells and triggers spem maturation
parasympathetic division in digestion
stimulation of digestive, actives, and promotes peristalsis
gallbladder
stores bile upon release of CCK, he gallbladder contracts and pushes bile out into the billiard tree
leading strand
strand that is copied in counties fashion
Memory of traumatic events
stress hormones increase the brain's avaiable supply of glucose energy, and the amygdala increases neuronal activty and the supply of proteins within the brain's meory sytems, producing strong, highly accessible memories
Base pair
strong implication of melting temperature essentially same shape and widths
Intermediate filaments
structurally important for cytoskeleton
equipoise
studies comparing two potential treatment options, one cannot approach the research with the knowledge that one treatment is superior to the other.
• Proteomics -
study of the proteome (all of the proteins produced) and how they interact with each other (not covered in this class)
counterculture
subculture characterized by section of population whose values and norms of behavior differ from those of society
Cohort
subjects are sorted into two groups based on difference in risk factor (exposures) and then assesed at various intervals to determine how many subjects in each group had a certain outcome ex. nosmokers vs smokers for lung cancer study
Selection bias
subjects used for study are not representative of the target population ex. someone volunteering for trial may be heather and morelikly to benefit than someone who doesn't volunteer because can't make to hospital also gender, age
Phoshphoenolpyrouvate and 1,3-BPG
substrate level phosphorylation produces ATP
Transient covalent bonding
substrates brifely contact active site residues sequentially
non-reducing disaccharide
sucrose carbohydrate that is not oxidized by a weak oxidizing agent (an oxidizing agent that oxidizes aldehydes but not alcohols, such as the Tollen's reagent) in basic aqueous solution...has a hemiacetal and hemiketal so it is safe in water
reducing sugars
sugars having anomeric carbon atoms that have not formed glycosides (acetal linkage) ex raffinose (oligosaccaride)
methionin
sulfur atom inside chaine
Midbrain
superior colliculus infereior colliculus
internal validy
support for casualty identification of causality in study between independent and dependent variables
thecal cells
surround granulose cells produce estrogen
symbolic interactionism
symbols how we codify concept to handgesters and body language
S stage
syntheis stage replicates its genetic material so that ecach dauagheter will have idential copies. After replication, each chromosome consists of tow identical chromatids that are bound together at the centromere. Ploidy of cell does not change
S phase (somatic)
synthesis phase of cell cycle; portion of interphase which DNA is replicated (2n)
Eicosanoids
synthesized from arrachidonic acid degrade easily inflammation, blood pressure, and blood clotting
Cholesterol
synthesized in a metabolic pathway contacting protein enzymes which catalyze each step enzymes are encoded by genes
Type IV RE
target modified DNA
culture lag
tendency for human technology to change more rapidly than culture forms that handle the effects of technology and determine how should be used
Weber's law
test threshold at which stimulus is detected
Gonads
testosterone and estrogen
sp3
tetrahedral 109.5º
anaphase of meiosis I
the 2 pairs of sister chromatids within a bivalent separate from each other but the connection between them doesnt break. each joined pair of chromatids migrates to one pole, and the homologous pair of chromatids moves to the opposite pole
Codons that specific the same amino acid can only differ in
the 3rd codon
Antisense strand
the DNA strand that is used as a template during transcription. Is therefore complimentary to the mRNA sequence. Also called the template strand. gives rise to the heavy strand of DNA
totipotency
the ability of a single cell to divide and produce all the differentiated cells in an organism
spatial summation
the additive effects are based on the number and location of the incoming signals A large number of inhibtory signals firing diretly on the somal will cuase more profouund hyperpolariztion of the axon hillock than the deploraization caused by a few excitaory signals friting on the dendrites of a neuron
appendicular skeleton
the bones of the arms and legs along with the bones of the pelvis and shoulder area
zwitterionic
the carboxyl group is negative, amine is positive, can be neutral at neutral pH
Anaphase II
the centromeres divdie, separating the chromosome into sister chromatids Chromatids are pulled to opposite poles by spindle fibers
Specificity
the change in the outcome variable is only produced by an associated change in the independent variable
Bipolar I
the client has at least one episode of mania alternating with major depression
fatty acids and temperature
the colder the temp the more unsaturated fatty acids -don't want the cell membrane to become solid when it gets cold
test cross
the crossing of an individual of unknown genotype with a homozygous recessive individual to determine the unknown genotype
Weber's Law
the degree to which an individual perceives differences differences are proportional
chyme
the digestion of solid food in the stomach
Hydrophobic effect
the exclusion of non-polar substances by water (critical for protein The propensity of hydrophobic molecules to part ion into a hydrophobic environment
Temporality
the exposure (independent variable) must occur before the outcome (dependent variable)
Kin selection
the idea that behaviors that help a genetic relative are favored by natural selection ...reproductive success is favored....related to altruism and intrusive fitness
grouptink
the idea that when an individual participates in a group, a consensus is always the most desired result
Double-blind experiment
the investigator, subject, and assure all do not know the subject's group
Residual volume (RV)
the minimum volume of air in the lungs when one exhales completely
bond angle trend
the more non-bonding electron pairs, the smaller the angle
Vertical mobility
the movement from one social level to a higher one or a lower one by either changing jobs or marrying.
coherence
the new data and hypothesis are cosnsitstenat with the current stat of scientific knowledge
mechanical advantage
the number of times a machine increases a force exerted on it MA=hypotenuse/ height
benefience
the obligation to act in the patients best interest
homophily
the overall similarity among members in the social system
Psychoanalytic perspective
the perspective that stresses the influences of unconscious forces on human behavior
absolute poverty
the point at which a household's income falls below the necessary level to purchase food to physically sustain its members
equivalence point
the point at which the two solutions used in a titration are present in chemically equivalent amounts
kinesthetic sense
the position and orientation of specific body parts
Modeling
the process of observing and imitating a specific behavior
Consitency
the relationship is found to e similar in multiple settings
vestibular sense
the sense of body movement and position, including the sense of balance
2nd proton removed is from
the side chain carboxyl group not the amine
Proteomics
the study of all the proteins encoded by the genome and their interactions
Cannon-Bard theory
the theory that an emotion-arousing stimulus simultaneously triggers (1) physiological responses and (2) the subjective experience of emotion
James-Lange theory
the theory that our experience of emotion is our awareness of our physiological responses to emotion-arousing stimuli
Expiratory reserve volume (ERV)
the volume of additional air that can be forcibly exhaled after a normal exhalation
proteins are excellent buffers because
the wide range of pKa values found within the protein
Transcription factor
then promote transcription of genes required for the next stage of the cell cycle
viable autosomal monosomies
there are none
Plausibilty
there is a reasonable mechanism for the independent variable to impact the dependent variable supported by existing literature
organic acid
there must be a covalent bond between a carbon and hydrogen atom in the molecular structure. Organic acids are weak acids, generally having formulas of R-CO2H, with the acidic hydrogen bonded to an oxygen atom.
relative refractory period
there must be greater than normal stimulation to cause action potential because membrane is starting form potential that is more negative than resting value
If capacitor is moved in the opposite direction of electron flow...
there will be no potential difference
Microenvironmnt adjustments
through the exclusion of water adjustment of the local environs' pH
Thyroxine
thyroid hormone is a tyrosine derived and increases metabolic rate
types of junctions
tight, adherens, desmosome, hemidemosome, and gap
Fermentation
to regenerate NADH pyruvate--- Lactate dehydrogenase ---> lactate (in uncial cells in an anaerobicc environment in yeast : pyruvate --->ethanol
Why do we centrifuge
to separate soluble and insoluble portions
Heterochromatin
too tightly wound to be accessed by cellular machinery before transcription can take place it must be first unwound constitutive heterochratin is permanently wound ant therefor is not transcribed
Chargaff's rule
total purines= total pyrimidines
Nuclear Factor
transcription factor that promotes gene expression of various cytokines, endothelial adhesion molecules, and interferon regulatory factors (IRF)
repressible operon
transcription is usually on, but can be inhibited (repressed) when a specific small molecule binds allosterically to a regulatory protein (example tryptophan)
Steroid hormones bidn to receptors in nucleus and directly regulate
transcription of RNA
passive imunity
transfer of antibodies to individual
Horizontal gene transfer
transfer of genes from one organism to another other than through reproduction
Phosphorylase
transfers a phosphate group to a molecule from inorganic phosphate
social reproduction
transmission of social inequality from one generation to the next
Collagen
trielical makes up most ECM connective tissue support and flexibility
Lateral Hypothalamus
triggers eating and drinking
chylomicrons
triglycerides and esterified cholesterol molecules are packaged into insoluble chylomicrons
fuel source available to hibernation animals, migrating birds, and creatures that really consume meals....and why
triglycerides because glucose obtained from a meal high in carbohydrates will only las for about eight ours
pancreatic peptidases
trypsinogen chymotrypsinogen carboxypeptidases A and B
Serotonin is biochemically drive from
tryptophan
eustchian tube
tube from ear to mouth pressure regulation
B-DNA
turn every 3.4nm and contains about 10 bases within span
Antibody structure
two identical heavy chains two identical light chains disulfide linkages and non covalent interactions hold the heavy and light chains to getter antigen-biding region (variable reaion/domain) at tips of Y
Integrins
two membrane-spaning chains called a and B. chain important in binding and comumunicating with the ECM improtant in cell signaling , promoting cel divison, apoptosis
dissociative identity disorder
two or more personalizes
DNA gyrase
type of topioisomerase that relieves supercoiling
Middle ear
typympanic membrane-->auditory canal--->malleus-->incus-->stapes (rest on oval window)
Complex III
ubiquinone: cytochrome c oxidoreductase; transfers electrons from QH2 to cytochrome c; protons are transferred from the matrix to the IMS
skeletal myocytes
unable to divide
implicit bias
unconscious, automatic biases measured by IAT; impacts decision-making and impressions (e.g., of other racial groups) without the person's conscious awareness first impression
Wernicke's area
understanding of written and spoken language
latent funcitons
unintended positive consequences on the parts of society unstated or unrecognized
cognitive dissonance
unpleasant feeling a person experience when holding two contradictory beliefs at the same time. ex. School is important...college tuition is wasted
Ungated channels
unregulated...no gates
linoleum acid
unsaturated fatty acid
DNA microarray florescence
up -regulated= green on a gene chip, however red to the eye down regulated= appear green neither up regulated nor down regulated = yellow
Bradford Protein Assay
used to determine protein conc. accurate when one type of protein is present limited by presence of detergent in sample
glycosidic bond
used to link monosaccharides
tosylate ion
used to make alcohol into better electrophile
Dialysis
used to remove small molecules such as salts from the sample and to exchange buffers for subsequent purification steps
Edman degradation
uses cleavage to sequence proteins removes N-terminal AA which can be analyzed by mass spec For larger proteins digestion with chymotrypsin, trypsin, and cyanogen bromide may be used and then analyzed using electrophoresis or Edman degradation....however their positions cannot be determined
Functional genomics
uses the data from genome sequencing projects to predict and describe gene and protein functions and interactions and ultimately, to understand how this produces the traits of an organism
In situ hybridization
using a labeled DNA or RNA probe to find a complementary nucleic acid sequence. • Can be used to locate the position of a gene or other unique DNA segment in a chromosome • Most common method uses fluorescently labeled DNA probes (usually made from cDNAs) • This is referred to as fluorescence in situ hybridization (FISH).
Bacterial knockouts created
using transposons
inducible operon
usually off, but can be stimulated (induced) when a specific small molecule interacts with a regulatory protein (example lac operon)
sound velocity equation
v=sqr(K/p) K= bulk modulus
monovalent
vaccine with only one antigen
monovalent
vaccine, antiserum, or antitoxin developed specifically for a single antigen or organism
Criterion validity
variable is able to predict a certain outcome.
independent variable
variable that is manipulated
dependent variable
variable that is observed
moderating variable
variable which changes the relationship between two other variables
Signal detection theory
various confusing or potentially misleading stimuli and tests whether a specific stimulus is detected
Expresivity
varying degree to which an allele manifests as a phenotype
Thromboxane
vasoconstriction; released by platelets, smooth muscle derived from arachidonic acid
ADH
vasopressin peptide hormone made by hypothalamus , released by posterior pituitary related in response to increase in plasma osmolarity immediate effect: increases water reabsorbing in the collecting doc effect on osmolarity and volume: decreases plasma osmolarity
migration velocity
velocity of electrophoresis migration v = Ez/f v= migragtion velcoity E= electric field strength f= frictional coeffient z= net charge on molecule
denaturing gel electrophoresis
vertical method that uses SDS in polyacrylamide to separate by size only, only primary structure remains intact confirms size
basilar membrane
vibrates-->hair cells depolarize-->electrical signals sent through the nerves
occipital
visual cortex
Superior colliculi
visual reflex center
To recharge battery
voltage must be larger than potentail of the cell
external anal sphincters
voluntary control (somatic)
motor cortex
voluntary muscle movements in response
acetylcholine
voluntary muscle ocontrol (PNS) and attention and arousal (CNS)
skeletal muscles
voluntary, multicellular, striated (overlapping strands of actin and myosin organized into sacromeres)
norepinephrine
wakefulnes and alertnes
Solubility of cholesterol and triglycerides
water insoluble and require carriers to travel through circulation
law of proximity
we tend to perceive objects close to each other in groups, rather than as a large collection of individual pieces.
The law of symmetry
we tend to perceive stimuli as grouped symmetrically around a center point.
law of closure
when a space is enclosed by a group of lines, it is perceived as a complete or closed line
somatic symptom disorder
when an individual complains of a symptom that is not linked to medical condition
agglutinate
when antibodies clump tighter
disjunction
when chromosomes come apart
Complete dominance
when dominant allele fully masks a recessive allele
Attrition bias
when participants drop out of a long-term experiment
foot-in-the-door technique
when someone has agreed to make a small commitment towards something, they are then much more likely to follow up with a greater commitment. Here, getting them to sign a petition would be a small commitment to increase their willingness to volunteer for the whole weekend.
Founder effect
when species are in reproductive isolation form other population genetic diversity decease so other trait prevalence increases
divergent evolution
when two or more species sharing a common ancestor become more different over time
Cornea
where light converges
fovea
where light is focused loated at focal point
Perilymph
where sound transmits
criterion validity
whether test reflects a certain set of abilities
Insertion of a DNA fragment into the MCS will disrupt (mutate) the LacZ gene,
white
Leukocytes
white blood cells produced in bone marrow divided into: granulocytes and granulocytes
pKa of chosen indicator
will be within +/- 1 unit of target pH
Citric acid cycle
will not occur in the absence of O2 because will lead to NADH and FADH because will not be consumed
Even numbered carbon chain
will oxidize into two carbons -last step uses 4-carbon chain
DNA polymerase a and d
work together to synthesize both the leading and lagging strand
Cluster C
worried -Avoidant -Dependent: need for reassurance from others -Obsessive-compulsive: Ego-syntoni, lack of die
Supercoiling
wrapping of DNA on itself as its helical structure is pushed toward the tellers during replication
After seven cycles of PCR how many strands of DNA will you see?
x= how many strands in DNA n=amount of cycles 2 * n^7= 128 two strands of dna therefore 128X2=256
binary
yes vs no, better vs.worse
1 day after fertilization
zygote divides
Day 3 of fertilization
zygote forms 16 blastomeres
coactivators
—proteins that increase the rate of transcription but do not directly bind to the DNA itself.
Cosmids
• Hybrid between a plasmid vector and phage λ • Can accept DNA fragments tens of thousands of bp long
Interest in stem cells centers around two main areas
• 1. They may help us understand the basic genetic mechanisms that underlie the process of development • 2. They offer the potential to treat human diseases or injuries that cause cell and tissue damage • This application has already become a reality • For example, bone marrow transplants are used to treat patients with certain forms of cancer
Nonspecific approach
• A mixture of primers with many different random sequences is used - Anneal randomly throughout the genome and amplify most of the chromosomal DNA
Gene addition versus gene replacement
• Cloned genes can be introduced into plant and animal cells • Needs to integrate into a host chromosome to be inherited by daughter cells • Needs to be present in the germ line if it is to be inherited in offspring • Integration occurs by recombination
Microorganisms are used to benefit humans in various ways
• Food fermentation • Production of medicine • Biological control • Bioremediation
- gene addition
• If a copy does, or does not, exist in the host genome the recombinant copy can undergo non-homologous recombination
gene replacement
• If a copy of the gene already exists in the host chromosome, the recombinant copy can undergo homologous recombination which results in • Can lead to ----- if the recombinant copy is defective.
Non-homologous recombination
• Middle of molecule recombined • Ends of molecule recombined • Neomycin resistant, gancyclovir sensitive
Eukaryotic chromosomes can be distinguished by
• Size • Location of centromeres • Banding patterns