BIO Chapter 10
What was wrong with Nic Volker's XIAP gene which caused his immune system to attack his digestive system?
the XIAP gene had a nucleotide substitution
Translation converts
the information stored in RNA to a polypeptide
The information carried by a DNA molecule is in
the order of the nucleotides in the molecule
The absence of a terminator in transcription will result in
the production of a longer RNA molecule
"DNA replication ensures ...."
"that each new cell receives its own copy of the DNA"
DNA and RNA have three basic differences. Other than their structural difference (double stranded DNA versus single-stranded RNA), what are their two chemical differences?
1. RNA contains uracil, DNA contains thymine 2. RNA has ribose, DNA has deoxyribose
HindIII is a restriction enzyme that cuts the DNA sequence AAGCTT between the two A bases. How many times would HindIII cut the following DNA molecule? GTAAGCTTCGACAAGCTTGCTGA
2 times
How many amino acids are common to all living systems?
20
A sample of DNA contains 30% adenine. What percentage of guanine does it contain?
20%
How many nucleotides make up a codon?
3
If adenine makes up 20% of the bases in a DNA double helix, what percent of the bases is guanine?
30%
How many of the codons actually specify an amino acid?
61
How many codons are there in total?
64
Approximately what percentage of the human genome consists of noncoding DNA?
98.5%
What do DNA and RNA have in common?
Both are composed of nucleotides
Which of the following is not a component of a nucleotide? A) A nitrogenous base B) A pentose (5-carbon sugar) C) A phosphate group D) All of the above are components of a nucleotide.
All of the above are components of a nucleotide
Guanine pairs with
Cytosine
Transcription
DNA and RNA
What is the best definition for recombinant DNA?
DNA that includes nucleotides from two different sources
True or false: A codon reads AUA. The anticodon that recognizes it is TAT.
False, it would be UAU because an anticodon is found on tRNA
True or false: The stop codons specify an amino acid.
False, the stop codon does not specify an amino acid.
The DNA codon GTA codes for an amino acid carried by a tRNA with the anticodon
GAU
How does the flow of genetic information differ in a retrovirus when compared to any cell?
In a retrovirus the flow is reversed. RNA → DNA instead of DNA → RNA
What is special about the codon AUG?
It is a start codon. Methionine is the only amino acid specified by just one codon, AUG.
What happens if a single amino acid is substituted in the hemoglobin gene
It may alter a protein so that it no longer functions properly
You are a biochemist working for a pharmaceutical company. You have been tasked with identifying a sample of nucleic acid. It is determined that the sample contains the bases cytosine, guanine, adenine, and phosphate groups. Will you be able to determine conclusively whether the sample is RNA or DNA?
No, because all of the listed components could be found in a sample of DNA or RNA.
Which of the following enzymes is responsible for RNA synthesis?
RNA polymerase
An enzyme called ______ converts the DNA message into an RNA message.
RNA polymerse
Of these steps, which one occurs earliest in the process of producing recombinant DNA?
Restriction enzymes are used to isolate the gene of interest and to cut the plasmid DNA.
A short sequence of DNA nucleotides that repeats one after the next is known as
STR
The codon AGC codes for the amino acid
Serine
transcription
The transfer of information from DNA into an RNA molecule
What is the relationship between the codon and the anticodon?
The codons and anticodons have complementary nitrogenous bases, allowing them to base pair.
phenotype
The collection of traits exhibited by an organism
You are a graduate student at the University of Iowa and working as a teaching assistant for a freshman introductory biology course. Two of your students have come to you with a question about the sequence of an mRNA transcribed from a gene. The original DNA sequence from which the mRNA was transcribed reads: TGACGATCGTA. The students were asked to provide the sequence of bases in the mRNA and came up with the following mRNA sequence: ACTGCTAGCAT. They are confused because their answer does not match the answer in the book. Briefly explain the very common mistake they made and what would the correct sequence be?
The students forgot that uracil takes the place of thymine in RNA. The correct sequence should be: ACUGCUAGCAU.
Are some mutations beneficial?
They lead to new versions of proteins that help organisms adapt to changes in their environment. and are essential for evolution to occur
A biochemist identifies a new toxin that closes the nuclear pores of a cell's nucleus. How would the cellular process be disrupted by this toxin?
Transcription would not be altered because it occurs in the nucleus. translation would be affected because it occurs on a ribosome in the cytosol of the cytoplasm.
The backbone of DNA consists of
a repeating sugar-phosphate-sugar-phosphate pattern
How were Watson and Crick able to rule out that the bases paired with themselves?
X-ray data indicated that a molecule of DNA had a uniform diameter. This would not be possible if the bases paired with themselves. complimentary base pairing
A mutation is
a change in the nucleotide sequence of DNA
You are a molecular biologist studying a defective human protein that is known to be a cause of a rare cancer. You isolate the suspected protein from a person with this cancer and compare it to the same protein in a person without the cancer. You discover that the protein isolated from the cancer patient is slightly smaller in size when compared to the protein from the unaffected patient. Furthermore, you discover that the protein from the cancer patient differs in almost every amino acid starting after the 23rd amino acid. What is the likely explanation?
a frame set mutation Specifically, it could have been either a nucleotide deletion or insertion.
Cystic fibrosis is a serious respiratory disease that is caused by the expression of a mutant form of the cystic fibrosis transmembrane regulator (CFTR) protein. Suppose that gene therapy was being used to attempt to treat cystic fibrosis. What biological component would be required for this treatment?
a virus that contains the healthy form of the CFTR gene in its genome
Which of the following processes occurs in the nucleus of a eukaryotic cell? A) RNA splicing B) Addition of a cap C) Addition of a tail D) All of the above occur in the nucleus of a eukaryotic cell
all
The shared genetic code of all life on Earth is evidence that
all life shares a common ancestry
According to the table of the genetic code, changing the second base of the codon
always changes the amino acid that is encoded
Peptide bonds form between
amino acids
What evidence led to the confirmation that Albert DeSalvo was the Boston Strangler?
an analysis of DNA from the crime scene
A _____ is a series of _______ bases that specify an amino acid
codon....3
When plasmids are used to produce a desired protein, the
desired gene is inserted into the plasmid, and the plasmid is taken up by the bacterium
STR analysis is a DNA profiling technique that makes use of the fact that different people have
different numbers of repeats of short DNA sequences at certain sites in the genome
"Sticky ends" are ________ that are produced by the action of ________.
double-stranded DNA molecules with single-stranded ends; restriction enzymes
After replication,
each new DNA double helix consists of one old strand and one new strand
The expressed (coding) regions of eukaryotic genes
exons
True or false: The flow of genetic information goes from RNA → DNA → protein
false
The process of making multiple copies of a gene by inserting it into a host genome and culturing the host is an example of
gene cloning
One of the critical aspects of Watson and Crick's discovery of the structure of DNA was that it
helped explain how DNA molecules can be copied to produce identical DNA molecules
The codon CAU codes for the amino acid
histidine
The world's first genetically engineered pharmaceutical product was
humulin
Translation occurs
in the cytoplasm on the ribosomes
Transcription occurs
inside the nucleus
RNA splicing removes ______ from the mRNA while keeping the ______.
introns.....exons
Gel electrophoresis separates DNA fragments on the basis of differences in their
length
Researchers tested RNA vaccines against the West Nile virus in dogs and cats. The study design for this experiment is shown in the figure. What group(s) was(were) the experimental groups?
low dose and high dose of vaccine for cats and low dose of vaccine for dogs only
The RNA that is translated into a polypeptide is
messanger RNA
DNA and RNA are polymers composed of
nucleotide monomers
While working with cultured mouse cells, a researcher unknowingly treated the cells with a mutagen that causes the deletion or insertion of individual nucleotides in DNA. Subsequently, the researcher isolated and cultured a single cell from this group and noticed that the progeny of this cell were not producing a certain protein, and that this affected their survival.The researcher isolated a different single cell and determined that it was producing a certain protein. However, the protein was much shorter than it should have been. What kind of mutation likely occurred in this protein?
one that introduced a premature stop codon
Which component of DNA gives it its negative charge?
phosphate group
A misfolded protein
prion
The region of DNA where RNA synthesis begins is the
promoter
Prions are infectious molecules that can cause brain diseases in several animals. What type of molecule is a prion?
protein
DNA replication
requires the cooperation of over a dozen enzymes and other proteins
Mutation in a gene that altered the original codon to a stop codon would
result in a shorter polypeptide chain.
A double-stranded viral RNA that inserts itself into a host cell's DNA and reverses the flow of genetic information
retrovirus
What organelle is directly responsible for protein synthesis?
ribosomes
Where is translation accomplished?
ribosomes
If you were asked to study the pattern of bacterial growth (increase in numbers over time) during an infection, you would find that numbers of bacteria increase exponentially up to a certain point. Assume that you have been asked to interpret the growth of bacteriophages. You infect the host bacteria and measure the increase of phages over a defined period of time. You plot the results and observe the graph shown here. Once viruses are detected, the number of viruses increases rapidly. This is because
the viruses lyse the hosts to release mature viruses quickly in a short amount of time the host cell speeds the release process
The state of human gene therapy today is that
there have been a small number of successes, including with the disease SCID
How is Zika virus most commonly transmitted?
through a single species of mosquito
adenine pairs with
thymine
Thymine and cytosine differ from adenine and guanine in that
thymine and cytosine are single-ring structures, whereas adenine and guanine are double-ring structures
What is the main function of the CRISPR-Cas9 system?
to alter the nucleotide sequences of specific genes in a living cell
Which of the following processes occurs in the cytoplasm of a eukaryotic cell?
translation
True or false: Adenine always pairs to thymine in DNA.
true
True or false: Plasmids are crucial in gene cloning because they can carry almost any gene.
true
True or false: The cap and tail are not part of the message used to construct a polypeptide.
true
True or false: The genetic code is in triplet, which specifies for 64 possible codes.
true
List the four bases that can be found in the nucleotides of DNA. In what way are they divided into two groups?
two purines (adenine and guanine) two pyrimidines (cytosine and thymine)
RNA contains the nitrogenous base ________ instead of ________, which is found only in DNA.
uracil... thymine
