Modern Biology Exam 3 Review

UAA/UAG/UGA codons

(Stop codon, signal to end the production of the polypeptide), doesn't code for an amino acid

If you analyzed RNA sample and you determined that 25% of the sample is made of G, what % of the sample is T. (answer only with number, no % sign needed)

0

Deletion mutations

1 or more nucleotide are deleted from DNA molecule

Insertion mutations

1 or more nucleotide inserted into DNA molecule

If "A" makes up 30% of DNA segment, what is the percentage of C in that strand? (type just the number as answer without % sign)

20

If you analyzed DNA sample and you determined that 25% of the sample is made of G, what % of the sample is T. (answer only with number, no % sign needed)

25

If "A" makes up 24% of DNA sample, what percentage is "G"? (just type in number)

26

How many Amino acids are coded by following RNA strand: AAAUGCGGUCAUGAAAGGCCAUU

3

Okazaki fragments made because DNA polymerase can only add nucleotides to

3' end

If DNA template strand is 5'-AACCTGCTA-3', what would be mRNA transcribed from it?

3'-UUGGACGAU-5'

If one strand of DNA is 5'AACGCGCTTT3', then other strand is / ___ /

3'TTGCGCGAAA5'

If analysis shows that 20% of DNA fragment is G, what is the percentage of T? (just type in the number)

30

If cell has total 4 chromosomes in G1 phase of Interphase,then it has __________chromatids in this phase.

4

If following is mature mRNA being translated, how many amino acids will you see in this polypeptide?5'-UAAUGGGAUUUGGCUGACCGAAGUUU-3'

4

Cell mentioned in Q3 has _____ chromosomes and ________ chromatids in Metaphase.

4 chromosomes, 8 chromatids

Cell mentioned in Q3 has ______ chromosomes and _______ chromatids in G2 stage.

4 chromosomes, 8 chromatids

How many Amino acids will be in polypeptide coded my this mRNA: AAGGAUGGGAGAUUGGCCUUAC

6

How many Amino acids will be in polypeptide coded my this mRNA: AAUGGGAGAUUGGCCUUACUGA

6

Cell mentioned in Q3 has ________ chromosomes and ________ chromatids in telophase.

8 chromosomes, 8 chromatids

Cell mentioned in Q3 has_______ chromosomes and __________ chromatids at the end of Anaphase.

8 chromosomes, 8 chromatids

What makes cancer malignant?

?

The individual chromosomes become visible with a light microscope during which stage of mitosis? A prophase B prometaphase C metaphase D anaphase

A. Prophase

Which of the following does cytosine pair with? A guanine B thymine C adenine D a pyrimidine

A.guanine

Which one of these is part of Chargaff's rule? (choose all that apply) Multiple answers:You can select more than one option A A=T B A=C C G=C D T=G

A=T, C=G

What is the sequence of START codon?

AUG

Function of Primase

Adds short RNA primer to DNA template

Which one of these would NOT be a reason for cell to regulate gene expression A Energy conservation B Conservation of materials C Response to environment D Specific developmental stage cell is in E All of these are correct

All of these are correct

If one DNA strands is 5'-AATACCG-3', then other strand will be A 5'-TTATGGC-3' B 3'-TTATGGC-5' C 5'-UUAUGGC-3' D 3'-UUAUGGC-5'

B 3'-TTATGGC-5'

The initial mechanism for repairing nucleotide errors in DNA is \text{ ________ } A mismatch repair B DNA polymerase proofreading C nucleotide excision repair D thymine dimers

B DNA polymerase proofreading

Which one of these is not correct statement regarding nucleotides A Nitrogenous base is linked to 1'-Carbon of deoxyribose B Phosphate group is linked to 3'-Carbon of deoxyribose C Phosphate group is linked to 5'-Carbon of deoxyribose D Phosphate group of one nucleotide links to 3'-Carbon of deoxyribose belonging to another nucleotide

B Phosphate group is linked to 3'-Carbon of deoxyribose

Which one of these statements is NOT true? A RNA strand is copied of the Template strand B RNA is a copy of the Template strand C RNA grows by adding nucleotides to 3' end of strand

B RNA is a copy of the Template strand

Chromosomes are duplicated during what portion of the cell cycle? A phase B S phase C prophase D prometaphase

B S phase

Why are Okazaki fragments necessary? A because DNA strand can only grow from 3' end towards 5' end B because DNA strand can only grow from 5' end towards 3' end C because RNA strand can only grow from 3' end towards 5' end D because RNA strand can only grow from 5' end towards 3' end

B because DNA strand can only grow from 5' end towards 3' end

Post-translational control refers to: A regulation of gene expression after transcription B regulation of gene expression after translation C control of epigenetic activation D period between transcription and translation

B regulation of gene expression after translation

An organism's traits are determined by the specific combination of inherited \text{ ________ } A cells B genes C proteins D chromatids

B. Genes

Function of DNA polymerase

Binds nuceotides to form new strands

How can we get multiple polypeptides based on single gene A By copying 2 different strands of DNA B By cutting out different exons C By cutting out different introns

By cutting out different introns

In DNA molecule, G always pairs up with / _ /

C

______ are changes to the nucleotides in a segment of DNA that codes for a protein. A Proto-oncogenes B Tumor suppressor genes C Gene mutations D Negative regulators

C Gene mutations

What is necessary for a cell to pass the checkpoint? A cell has reached a sufficient size B an adequate stockpile of nucleotides C accurate and complete DNA replication D proper attachment of mitotic spindle fibers to kinetochores

C accurate and complete DNA replication

Separation of the sister chromatids is a characteristic of which stage of mitosis? A prometaphase B metaphase C anaphase D telophase

C anaphase

Prokaryotes contain a \text{ ________ } chromosome, and eukaryotes contain \text{ ________ } chromosomes. A single-stranded circular; single-stranded linear B single-stranded linear; single-stranded circular C double-stranded circular; double-stranded linear D double-stranded linear; double-stranded circular

C double-stranded circular; double-stranded linear

Which eukaryotic cell-cycle event is missing in binary fission? A cell growth B DNA duplication C mitosis D cytokinesis

C mitosis

The RNA components of ribosomes are synthesized in the ______. A cytoplasm B nucleus C nucleolus D endoplasmic reticulum

C nucleolus

A gene that codes for a positive cell cycle regulator is called a(n) ______ A kinase inhibitor B tumor suppressor gene C proto-oncogene D oncogene

C proto-oncogene

A diploid cell has \text{ ________ } the number of chromosomes as a haploid cell. A one-fourth B one-half C twice D four times

C twice

If "A" makes up 24% of RNA sample, what percentage is "T"? A 26 B 24 C 0 D Can't tell

C.0

Prometaphase

Chromosomes attach to mitotic spindle fibers

Function of Ligase

Create covalent bond between adjacent DNA segments(glues DNA pieces together)

Cytokinesis

Cytoplasm and cell membranes divide

Which one of these is not correct? A Gene is a continuous strand of nucleotides coding for mRNA B Gene starts with Promotor C Gene ends with Terminator D Information from gene is copied into mRNA through translation

D Information from gene is copied into mRNA through translation

Control of gene expression in eukaryotic cells occurs at which level(s)? A only the transcriptional level B epigenetic and transcriptional levels C epigenetic, transcriptional, and translational levels D epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels

D epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels

Portions of eukaryotic mRNA sequence that are removed during RNA processing are ____. A exons B caps C poly-A tails D introns

D introns

FtsZ proteins direct the formation of a ______ that will eventually form the new cell walls of the daughter cells. A contractile ring B cell plate C cytoskeleton D septum

D septum

If "A" makes up 24% of RNA sample, what percentage is "G"? A 26 B 24 C 0 D Can't tell

D. Can't Tell

Which one of these is NOT a function of mitosis A Growth B Development C Regeneration D Sexual production

D.Sexual Production

Which one of these is not true? A DNA has double helix, and RNA has single strand B DNA is larger than RNA C DNA has U, and RNA has T D DNA has deoxyribose, and RNA has ribose E DNA is in nucleus, while most of RNA is located in cytoplasm

DNA has U, and RNA has T

S Phase

DNA replication

Expanding repeat mutations

DNA segment is being duplicated so it repeats in more and more copies through generations

M checkpoint

Do kinetochores attach to spindle? Are chromosomes aligned down equator?

Which one of these are NOT part of Interphase? (choose all that apply) Multiple answers:You can select more than one option A G0 B G1 C G2 D S E Prophase F Mitosis

E Prophase F Mitosis

Which one of these is not a way that eukaryotes can stop gene expression (production of polypeptide) in eukaryotes? A Chromatine remodeling B Preventing transcription C preventing RNA processing D affecting mRNA stability E Blocking translation F Inactivating protein G All of the above are ways that eukaryotic cell can use to control gene expression

G All of the above are ways that eukaryotic cell can use to control gene expression

G1 phase

Gap 1(growth 1) stage=growth of the cell and replication of organelles

G1 checkpoint

Is DNA damaged

S checkpoint

Is DNA replicating correctly

G2 checkpoint

Is all DNA replicated and can mistakes be fixed; is spindle-making machinery in place

Silent Mutations

Mutation does not change sequence of amino acids in polypeptide

Since Lactose can bind to repressor and remove it from Operon allowing the RNA polymerase to copy the genes, we would consider this to be A Negative feedback B Positive feedback

Negative Feedback

Early Prophase

Nuclear envelope starts breaking apart and chromosomes are getting more visible

Because lagging strain is running 3' to 5' but nucleotides can only be added to the 3' end, this DNA strand is copied in small sections called

Okazaki Fragments

Point Mutation

Only one nucleotide is changed

Initiation(transcription)

RNA Polymerize binds to Promoter starting Transcription

Termination(transcription)

RNA polymerizer reaches terminator and disassociates with DNA and newly made RNA ending the transcription

Which one of these is NOT part of Lac Operon A Promotor B Operator C Repressor gene D 3 genes coding for 3 different polypeptides

Repressor Gene

Termination(translation)

Ribosome identifies stop codon

Anaphase

Sister chromatids separate and move towards opposite sides of the cell

Function of Binding Proteins

Stabilize unwinded DNA strands

AUG codon

Start codon that signifies the start of protein encoding

In DNA, A nucleotide always pairs up with / __ /

T

If one DNA strand has AAGGCCTA sequence, what would be sequence of its complimentary strand

TTCCGGAT

2 DNA strands are antiparallel, meaning one has 5'-3' direction and the other one has 3'-5' direction A True B False

True

True/False. Chromatin is made of nucleosomes

True

True/False. Nucleosomes are made of DNA strand coiling with histones

True

True/False. One gene can code for multiple polypeptides because cell can remove different combinations of introns from mRNA during processing

True

Telophase

Two new nuclear envelopes are formed around two sets of chromosomes

Which one of these is not present in DNA molecule? A. A B. C C. T D. U E. G

U

What would be the anti-codon on tRNA that carries Amino Acid Methionine

UAC

List one STOP codon

UGA, UAA, UAG

If template DNA strand is AATACCG, then mRNA strand will be

UUAUGGC

Function of Helicase

Unwinding DNA helix

Elongation(translation)

addition of amino acids to growing polypeptide chain

In which stage of Mitosis do sister chromatids (identical copies of the chromosome) separate from each other

anaphase

Nonsense Mutations

cause premature appearance of stop codon

Missense mutations

cause substitution of one amino acid with another amino acid

What is the reason why plant cells cannot create cleavage furrow during cytokinesis?

cell wall

Mutations are _____ in DNA sequence.

changes

Metaphase

chromosomes align in the middle of the cell

Where does Translation occur?

cytoplasm

Which one of these is not correct regarding mRNA processing A PolyA tail is added B cap is added C exons are removed

exons are removed

Fill in the Blanks During Binary fission cell divides into 2 _______ cells

identical

Frameshift mutations

insertion or deletion of 1 or more nucleotide causing shift in "code reading frame" which then causes change of amino acid sequence

In which stage of Mitosis is DNA replicated

none

elongation(transcription)

nucleotides are added to growing RNA molecule

Where does DNA transcription occur?

nucleus

G2

production of enzymes needed in cell division

Because newly made DNA molecule contains one "parental" strand, and second strand is newly synthesized, we say that DNA replication is /___ /.

semi-conservative

DNA replicates by which of the following models? A conservative B semiconservative C dispersive D none of the above

semiconservative

Initiation(translation)

tRNA carrying anti-codon of Start codon binds to Ribosomal-mRNA complex

Fill in the Blanks Nuclei contain single chromosomes in _______ and ______ stages of Mitosis

telophase and cytokinesis