Module #2

The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of the following labeled components: hydrogen. nitrogen and oxygen. phosphorous and sulfur. tritium. None of these answers are correct.

Phosphorus and sulfur

_____________ is seen primarily among prokaryotes where one mRNA carries coding information and internal punctuation for the translation of more than one protein.

Policystronic

In eukaryotes, what factors (either DNA sequences or proteins) appear to encourage the specific association of RNA polymerase(s) to a specific region of DNA?

Promoters, enhancers, and transcription factors

Certain triplets (AUG) commonly signal the starting point for protein synthesis, while other triplets typically signal stop (UAA, UGA, UAG). In terms of the genetic code, what is the term for this type of signal?

Punctuation (initiation, termination). AUG (rarely GUG) for initiation; UAA, UGA, and UAG for termination

Heinz Shuster collected the following data on the base composition of ribgrass virus (H. Schuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. NY: Academic Press, 1955). On the basis of this information (see below) is the hereditary information of the ribgrass virus RNA or DNA? Is it likely to be single stranded or double stranded? Percent: A: 29.3 G: 25.8 C: 18.0 T: 0.0 U: 27.0 Mark the correct boxes below: RNA single stranded double stranded

RNA Single-stranded

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe. RNA Pol I; RNA Pol II; RNA Pol III a. mRNA b. tRNA c. rRNA d. snRNA

RNA Pol I: c RNA Pol II: a, d RNA Pol III: b, c, d

What are the two major components of the Tobacco Mosaic Virus? RNA and protein lipids and nucleic acids DNA and protein carbohydrates and nucleic acids RNA and DNA

RNA and protein

5' ...GGAGCUCGUUGUAUU... 3' Reference: Ref 15-4 Is this sequence RNA or DNA? How can you tell?

RNA because of the uracil

Which of the following statements is not true concerning RNA and DNA? DNA is transcribed into RNA which is translated into protein RNA is more stable than DNA DNA is permanent in a cell, RNA is temporary The sugar portion of RNA and DNA are different

RNA is more stable than DNA

a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA Reference: Ref 13-1 This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil. Enter only the letter of your choice.

RNA only

During DNA replication, what is the function of RNA primase?

RNA primase provides a free 3'-OH group which DNA polymerase depends upon

This short piece of RNA is present only transiently in a newly-synthesized DNA molecule.

RNA primer

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. DNA primase

RNA primer synthesis

Below is a list of several phenomena relating to protein structure. Clearly describe each phenomenon, the conditions under which each occurs, and the probable influence each has on protein structure. - Hydrophobic interactions - Hydrogen bonds - Disulfide bridges

- Hydrophobic interactions: Nonpolar side chains of amino acids tend to associate to form hydrophobic clusters usually away from the protein surface. - Hydrogen bonds: Such bonds may occur between the components of the peptide bond, the side chains, or a combination of the two. They are responsible for helical and pleated sheet structures of proteins. - Disulfide bridges: Such bonds are formed between two cysteine side chains and, because of their covalent nature, represent relatively strong attractive forces between different regions (sometimes distant) of proteins.

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason for your choice. A: GCATTAGGGCATCCC CGTAATCCCGTAGGG B: TTAGCGTTATAGCAT AATCGCAATATCGTA Mark the correct boxes below: DNA molecule B DNA molecule A DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule A has a higher A-T content DNA molecule B has a higher A-T content

-DNA molecule A -A has higher GC content. -B has higher AT content.

What is the chromosomal configuration of the phiX174 virus? Check all that apply. double-stranded circular linear DNA single-stranded

-circular -DNA -single stranded

What is the chromosomal configuration of the phiX174 virus? Check all that apply. single-stranded double-stranded circular linear DNA

-circular -DNA -single stranded

Which one of the following statements regarding eukaryotic transcriptions is not true? Chromatin remodeling is necessary before certain genes are transcribed. Eukaryotic transcription involves a core promoter and a regulatory promoter. A group of genes is transcribed into a polycistronic RNA. There is no one generic promoter.

A group of genes is transcribed into a polycistronic RNA.

What is the function of the TATA binding protein? Allows eukaryotic RNA polymerase II to bind to the promoter of genes Allows prokaryotic RNA polymerase to bind to the promoter of genes Helps termination factors bind and terminate transcription. Aids in the removal of introns from eukaryotic pre-mRNA

Allows eukaryotic RNA polymerase II to bind to the promoter of genes

What is meant by the term heterogeneous nuclear RNA (hnRNA)?

An assortment of RNA molecules assembled around newly transcribed RNA (pre-messenger RNA, or pre-mRNA) in the cell nucleus.

What is meant by the term antiparallel?

Antiparallel: A term applied to two molecules that are side by side but run in opposite directions. The two strands of DNA are antiparallel. The head of one strand is always laid against the tail of the other strand of DNA.

Antisense oligonucleotides are relatively short stretches of nucleotides (usually about 20 nucleotides long) that are likely to bind with sense RNAs in a given cell. Of what importance might such a material have in human health?

Antisense oligonucleotodes can be used in gene therapy. If a genetic sequence is known to cause a particular disorder, an oligonucleotide can be synthesized that will bind to the mRNA coded by the sequence. When the oligonucleotide binds to the mRNA it inactivated it, effectively shutting the gene off.

What three possible models were suggested to originally describe the nature of DNA replication? Check three below. continuous dispersive semiconservative semidispersive conservative

-conservative -semiconservative -dispersive

Assume that A + T/G + C equals 0.5 in one strand of DNA. What is the ratio of these bases in the complementary strand?

0.5

List 3 requirements of any substance that is "genetic material"

1. It must be able to reproduce itself 2. It must control which traits were expressed 3. It must be able to change in a controlle way, in order to ensure survival of a species in exchanging environment

Present two forms of post-translational modification of proteins.

1. histone proteins 2. hydroxylation 3. gamma-carboxylation 4. glycosylation 5. disulfide

Suppose that in the use of polynucleotide phosphorylase A and C are present in a ratio of 1A:5C. What is the probability that an AAA sequence will occur?

1/216

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine? 31 12 38 24

12

In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (15N) and then transferred them to a medium containing 14N. Which of the results in the above figure would be expected after one round of DNA replication in the presence of 14N?

14N-15N hybrid DNA

Meselson and Stahl determined that DNA replication in E coli is semiconservative. What additive did they initially supply to the medium in order to distinguish "new" from "old" DNA? 33P 14N S 15N 32P

15N

Which of the following are among the major components of prokaryotic ribosomes? 18S rRNA, 5.8S rRNA, and proteins 16S rRNA, 5S rRNA, and 23S rRNA lipids and carbohydrates 12S rRNA, 5.8S rRNA, and proteins 16S rRNA, 5.8S rRNA, and 28S rRNA

16S rRNA, 5S rRNA, and 23S rRNA

A protein is 300 amino acids long. Which of the following could be the number of nucleotides in the section of DNA that codes for this protein? (Remember: DNA is double-stranded.) 300 1800 3 500 10018

1800

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins?

2

An organism has a G content of 30%. What is the percentage for A?

20%

Assuming that an amino acid sequence is 250 amino acids long, how many different molecules, each with a unique sequence, could be formed?

20^250

At what approximate wavelengths do DNA, RNA, and proteins maximally absorb light? DNA: ____ nm RNA: ____ nm Protein: ____ nm

260, 260, 280

Which of the following DNA sequences could be the template for a piece of mRNA with the sequence: 5' UGC CGA CGU AGG 3' 5' ACG GCT GCA TCC 3' 5' TGC CGA CGT AGG 3' 3' ACG GCT GCA TCC 5' 3' TGC CGA CGT AGG 5'

3' ACG GCT GCA TCC 5'

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? 3' AUG 5' 3' ATC 5' 5' ATC 3' 5' AUG 3'

3' AUG 5'

A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is 3' UCA 5' 3 'ACU 5' 5' TCA 3' 3' UGA 5

3' UCA 5'

When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing. 5' base 3' base middle base

3' base

In one strand of DNA, the nucleotide sequence is 5'-ATGC-3'. The complementary sequence in the other strand must be: 3'-TACG-5' 5'-CGTA-3' 5'-ATCG-3' 5'-TACG-3' 3'-ATGC-5'

3'-TACG-5'

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.

3'AGC 5' 3'AGG 5' 3' AGU 5' 3' AGA 5'

An organism has a T content of 20%. What is the percentage for C?

30%

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)? 60% 30% 35% 70%

30%

If a DNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it have? 35 15 60 30 10

35

Which of these sequences could form a hairpin? 5' TTTTTTCCCCCC 3' 5' AAAAAAAAAAAA 3' 5' GGGGTTTTCCCC 3' 5' ACACACACACAC 3'

5 GGGGTTTTCCCC 3

What structural circumstance in DNA sets up the requirement for its semidiscontinuous nature of replication?

5' > 3' polarity restrictions of DNA synthesis and the antiparallel orientation of the DNA strands in DNA

Which of these sequences, if paired with its complementary strand, would be a palindrome? 5' CCCCCC 3' 5' CCCGGG 3' 5' CTGCTG 3' 5' TCCCCT 3'

5' CCCGGG 3'

If the following DNA strand was used as a template, what would the sequence of an RNA be? 5' GTACCGTC 3' 5' GACGGTAC 3' 5' GUACCGUC 3' 5' CAUGGCAG 3' 5' GUCGGUAC 3' 5' GACGGUAC 3'

5' GACGGUAC 3'

Select three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes. heteroduplex formation, base modification, capping 5'-capping, 3'-poly(A) tail addition, splicing 5'-poly(A) tail addition, insertion of introns, capping 3'-capping, 5'-poly(A) tail addition, splicing removal of exons, insertion of introns, capping

5'-capping, 3'-poly(A) tail addition, splicing

The ribonucleic acid components known to exist in eukaryotic ribosomes are the following: (check all that apply) 5S 28S 16S 5.8S 18S

5.8S 28S 5S 18S

You are producing a heteropolymer of synthetic mRNA using a 1C:5G ratio. In this synthetic mRNA what is the proportion of codons with 2Gs and 1C? 125/216 75/216 1/216 25/216

75/216

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids? 1200 900 600 100 300

900?

Briefly define the term "autoradiography". Identify and describe a classic experiment that used autoradiography to determine the replicative nature of DNA in eukaryotes.

Autoradiography is a technique that allows an isotope to be detected within a cell: The Taylor, Woods, and Hughes (1957) experiment used 3H-thymidine.

An intron is a section of DNA that is removed during DNA processing. transfer RNA that binds to the anticodon. carbohydrate that serves as a signal for RNA transport. RNA that is removed during RNA processing. protein that is clipped out post-translationally.

RNA that is removed during processing of RNA

The "RNA World" theory suggests that: RNA is the intermediate between DNA and proteins. many RNAs are capable of self-splicing. RNA viruses are more dangerous than DNA viruses. eventually RNA will become the genetic material of most living organisms. RNA was the genetic material in the first living cells.

RNA was the genetic material in the first living cells.

Referring to the genetic code, what is meant by "wobble"?

Relaxed pairing specificities in the third-base position of a codon.

One form of post-translational modification of a protein includes removal of exons. removal of introns. removal or modification of terminal amino acids. shuffling of exons. self-splicing.

Removal or modification of terminal amino acid

One form of post-translational modification of a protein includes shuffling of exons. removal of introns. self-splicing. removal or modification of terminal amino acids. removal of exons.

Removal or modification of terminal amino acid

What is the name of the replication unit in prokaryotes, and how does it differ in eukaryotes?

Replicon; one replicon in prokaryotes, multiple replicons in eukaryotes

Translation of RNA into protein takes place on which cellular organelle? tRNA Ribosome Polymerase Nucleus

Ribosome

Considering the Central Dogma of Molecular Biology, what three general properties are ascribed to DNA?

Storage and expression of information, variation through mutation

Regarding the efficient initiation of transcription by RNA polymerase II, what two major types of "upstream" signals appear to be involved?

TATA and CAAT base sequences, and enhancers

Type the complementary strand to the following single-stranded DNA. 5' - ATAGCATGGGCCATACGATTACTGA - 3' Type your answer from 5' to 3', but INCLUDE ONLY the DNA sequence in your typed answer, NOT 5' or 3' characters.

TCAGTAATCGTATGGCCCATGCTAT

Which of these sequences could form a hairpin? TTCAATAATCGCTAATAACTGA GCCGCCGCCGCCCCATTATTATTAT CGCCAAAAAATCGCCCCCCAATTA ATTATTGGCGCTAACGCCAATTTT ATTATTTCGTACCCCCAATTTT

TTACGGCGGTTCCGCCGGTG

In the classic experiment conducted by Hershey and Chase, why was the pellet radioactive in the centrifuge tube that contained bacteria with viruses, which had been grown on medium containing 32P? The bacteria were in the pellet, and they had incorporated radioactive proteins into their cell membranes. The radioactive viruses (coats plus DNA) were in the pellet. The radioactive viruses were in the pellet, and the bacteria were in the supernatant. The bacteria were in the pellet, and many contained the radioactive viral DNA. The radioactive protein coats of the viruses were in the pellet.

The bacteria were in the pellet, and many contained the radioactive viral DNA.

Which of the following are role(s) of the 5' cap? The cap helps the RNA polymerase find the promoter and initiate transcription. The cap protects the RNA from degradation. none of the above The cap acts as a binding site for the ribosome. The cap plays a role in the removal of introns.

The cap plays a role in the removal of introns. The cap acts as a binding site for the ribosome. The cap protects the RNA from degradation.

DNA replication in vivo requires a primer with a free 3' end. What molecular species provides this 3' end, and how is it provided?

The free 3' end is provided by an RNA primer, which is provided by the enzymatic activity of RNA primase

It has been recently determined that the gene for Duchenne muscular dystrophy (DMD) is over 2000 kb (kilobases) in length; however, the mRNA produced by this gene is only about 14 kb long. What is a likely cause of this discrepancy? The DNA represents a double-stranded structure, while the RNA is single stranded. When the mRNA is produced, it is highly folded and therefore less long. There are more amino acids coded for by the DNA than the mRNA. The exons have been spliced out during mRNA processing. The introns have been spliced out during mRNA processing.

The introns have been spliced out during mRNA processing.

Translation is directly dependent on all of the following associations except _______. complementary base pairing between mRNA and tRNA association of the 30S and the 50S ribosomal subunits complementary base pairing between mRNA and rRNA complementary base pairing between mRNA and DNA

complementary base pairing between mRNA and DNA

The ribosome is the primary site of: amino acid storage. cellular respiration. protein synthesis. protein packaging. oxidative phosphorylation.

protein synthesis

Name the pyrimidines and the purines in DNA.

purines adenine (A) and guanine (G) pair up with the pyrimidines thymine (T) and cytosine (C),

The complex of proteins that is involved in the replication of DNA is called a ________.

replisome

Uridine contains __________ as sugar.

ribose

The discovery of RNA self-splicing by T. Cech (1982) and others in Tetrahymena revealed that RNA can demonstrate autonomous catalytic properties. RNAs that undergo such splicing are often called ________.

ribozymes

Which of the following terms accurately describes the replication of DNA in vivo? nonlinear nonreciprocal conservative semidiscontinuous dispersive

semi-discontinuous/semi-conservative

This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates.

semiconservative replication

Hairpins are formed in DNA as a result of sequences on the opposite strand that are identical sequences on the opposite strand that are complementary sequences on the same strand that are identical sequences on the same strand that are inverted and complementary

sequences on the same strand that are inverted and complementary

The 3' untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence. a. translation b. splicing c. stability d. transcription

stability translation

Telomeres________________the end of chromosomes destabilize stabilize transcribe replicate

stabilizes

What are the four nucleotides that make up RNA? Give full names, not abbreviations.

Adenine (A), guanine (G), cytosine (C), and uracil (U)

Which of the following best describes the addition of nucleotides to a growing DNA chain? A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate. A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate.

A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate

What is a gene? A sequence of amino acids that catalyze a reaction A sequence of DNA that encodes a protein A sequence of DNA that tells polymerase where to begin transcription A sequence of RNA that regulates expression

A sequence of DNA that encodes a protein

In an analysis of the nucleotide composition of double-stranded DNA to see which bases are equivalent in concentration, which of the following would be true? Both B and C are true. A = G and C = T A + C = G + T A = C A + T = G + C

A+C=G+T

Three forms of DNA are... (Check three answers). A-DNA R-DNA L-DNA B-DNA Z-DNA

A, B, Z

3' TACCGTGCGTGACATTAAGCC 5' Reference: Ref 10-5 What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? Type the sequence from 5' to 3', but DO NOT INCLUDE 5' and 3' characters.

ATGGCACGCACTGTAATTCGG

Approximately how much of the mammalian genome is composed of repetitive DNA?

About 5% to 10% of a mammalian genome is highly repetitive; about 30% is moderately repetitive.

Which is true of the secondary structure of DNA? Thymine pairs with guanine Bases on complementary strands are held together by hydrogen bonds. Sugar-phosphate groups are on the inside of the DNA molecule. Cytosine pairs with adenine. Nucleotide bases are on the outside of the DNA molecule.

Bases on complementary strands are held together by hydrogen bonds.

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences? TTTTAAAA, GGGGCCCC GGTTC, TTAT CAAT, TATA any trinucleotide repeat

CAAT, TATA

Electrophoretic separation of HbA from HbS is based on a difference in their ________.

Charges

This form of DNA replication was eliminated during the Meselson-Stahl experiment because the original double-helix did not appear to be preserved during cell division.

Conservative Replication

The long-term storage of genetic information in a cell occurs in the: RNA microRNA DNA mRNA

DNA

What chemical group is found at the 5' end of a DNA molecule? dideoxy group carboxyl group nitrogenous base sulfate group phosphate group hydroxyl group

Phosphate group

In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts? DNA contains purines, whereas protein includes pyrimidines. DNA contains nitrogen, whereas protein does not. DNA contains phosphorus, but protein does not DNA contains sulfur, whereas protein does not.

DNA contains phosphorus, but protein does not

Supercoiling caused by unwinding of the dsDNA molecule is relieved by what enzyme?

DNA gyrase OR topoisomerase

This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them.

DNA ligase

a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA Reference: Ref 13-1 When this molecule is synthesized, both strands of a DNA molecule are used as a template.

DNA only

Viral chromosomes exist in a variety of structures and can be made up of the following: protein or lipid-coding sequences DNA only RNA only DNA, RNA, or protein DNA or RNA

DNA or RNA

Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction? DNA ligase DNA polymerase III primase topoisomerase

DNA polymerase III

Which of the following enzymes are known to be involved in the replication of DNA in bacteria? Check all that apply. RNA Polymerase II DNA Polymerase II ligase DNA Polymerase I RNA primase

DNA polymerase III ligase RNA primase

In biology, most information flows through which sequence? DNA to RNA to protein protein to DNA to RNA RNA to DNA to protein protein to RNA to DNA

DNA to RNA to protein

Explain at least two reasons why the following definition of a gene is incomplete: "A gene consists of DNA sequences that encode a single polypeptide."

Definition does not include 1. regulatory sequences 2. not all genes are DNA sequences (see RNA virus) 3. not all genes transcribe a single RNA molecule 4. not all RNA molecules encode for a single polypeptide. Answer should have 2 of these elements (or others that make sense).

In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?

Dispersive replication

What protein is responsible for the initial step in unwinding the DNA helix during replication of the bacterial chromosome?

DnaA

Which of the following statements is NOT true about enhancers? Enhancers contain sequences that are recognized by transcription factors. Enhancers represent control elements located far away from the promoter. Enhancers are recognized by and bind directly to RNA polymerase. Enhancers can be located thousands of nucleotides upstream of downstream of the gene they affect. Enhancers can differ for each gene in a eukaryotic cell (although overlap is possible).

Enhancers are recognized by and bind directly to RNA polymerase.

Describe a difference between the RNA polymerases of eukaryotes and prokaryotes.

Eukaryotes have three types of RNA polymerases, I, II, and III, and prokaryotes only have one type.

A(n) ________ is a section of an RNA that gets spliced out

Exon

Two "naked" (without histones or other proteins) double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?

Fragment A likely has a low Gaunosine/Cytosine content than fragment B. Because Guanosine/Cytosine has 3 h-bonds and Adenine/Thymine only has 2 h-bonds, more energy (higher termperature) is required to break apart the G/C rich fragment.

If the GC content of a DNA molecule is 60%, what are the molar percentages of the four bases (G, C, T, A)? G = _____ %. C = _____%. A = _____%? T = _____%?

G = 30%, C = 30%, T = 20%, A = 20%

If the GC content of a DNA molecule is 60%, what are the molar percentages of the four bases (G, C, T, A)? G = _____ %. C = _____%. A = _____%? T = _____%?

G = 30%, C = 30%, T = 20%, A = 20%

The nitrogenous base that is found in RNA but not in DNA is None of the above adenine guanine cytosine uracil

uracil

Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are separated by large stretches of repetitive DNA. each void of typical protein-coding sequences of DNA. void of introns. uniform in the genetic information they contain. called heterochromatin and euchromatin

Heterochromatin and euchromatin

What is unusual about the amino acid composition of histones? How is the function of histones related to the amino acid composition? Of which histones are nucleosomes composed?

Histones contain large amounts of positively charged amino acids such as lysine and arginine. Thus, they can bind electrostatically to the negatively charged phosphate groups of nucleotides. Nucleosomes are composed of all histones except H1.

Briefly describe what is meant by the term exon shuffling.

In the 1970s, Walter Gilbert suggested that the functional regions of genes in eukaryotes consist of collections of exons originally present in ancestral genes that are brought together through various recombination events over time.

Describe the role of the various types of nucleic acids in the storage and expression of information in living organisms.

Information contained in the base sequences of DNA is transcribed into a variety of RNAs. Certain RNAs (tRNA) carry amino acids to the site of translation where proteins are assembled. Other RNAs (mRNA and rRNA) provide a mechanism for ordering the sequence of amino acids in proteins.

Q: Describe the role of the various types of nucleic acids in the storage and expression of information in living organisms.

Information contained in the base sequences of DNA is transcribed into a variety of RNAs. Certain RNAs (tRNA) carry amino acids to the site of translation where proteins are assembled. Other RNAs (mRNA and rRNA) provide a mechanism for ordering the sequence of amino acids in proteins.

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? UAA, UGA, and UAG are initiator codons, not termination codons. Exons are spliced out of mRNA before translation. These triplets cause frameshift mutations, but not termination. Introns are removed from mRNA before translation. More than one termination codon is needed to stop translation.

Introns are removed from mRNA before translation

Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? More than one termination codon is needed to stop translation. Introns are removed from mRNA before translation. Exons are spliced out of mRNA before translation. These triplets cause frameshift mutations, but not termination. UAA, UGA, and UAG are initiator codons, not termination codons.

Introns are removed from mRNA before translation.

There is some indication that the code is in some way ordered; a certain pattern exists. Name an observation that supports this view.

It has been observed that amino acids that are chemically similar share the middle base of their respective codons. Also, codons that share the same two starting nucleotides frequently encode the same amino acid.

This new strand of DNA has its 3' end oriented in the same direction as the replication fork travels.

Leading

Significant in the deciphering of the genetic code was the discovery of the enzyme polynucleotide phosphorylase. What was this enzyme used for? ribosomal translocation production of ribosomal proteins peptide bond formation degradation of RNA the manufacture of synthetic RNA for cell-free systems

Manufacture of synthetic RNA for cell-free systems

In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exists. What is it called, and what types of elements are involved? permissive DNA, centromeres and heterochromatin dominant DNA, euchromatin and heterochromatin moderately repetitive DNA, SINEs, LINEs, and VNTRs composite DNA, telomeres and heterochromatin multiple gene family DNA, hemoglobin and 5.0S RNA

Moderately repetitive DNA, SINEs, LINEs and VNTR

Describe the function of N-formylmethionine in prokaryotes.

N-formylmethionine or fMet is a derivative of amino acid Methionine. In this derivative a formyl group is added to the Methionine. In prokaryote, specifically in bacteria the N-formylmethionine is used as start codon for protein synthesis or in other words it initiates the protein synthesis process.

The one-gene, one-enzyme hypothesis emerged from work on which two organisms? E. coli and humans Drosophila and humans all of the answers listed Neurospora and Drosophila E. coli and yeast

Neurospora and Drosophila

Which of the following features distinguishes RNA from DNA? DNA has only purine bases None of the above RNA has a pentose sugar while DNA utilizes a hexose sugar Unlike RNA, DNA uses a phosphodiester backbone RNA has only pyrimidine bases

None of the above

Which of the following statements about a mammalian messenger RNA are FALSE? It usually contains a cap at the 5' end. It is synthesized in the nucleus. It is usually much smaller than the initial transcript (that is copied directly from the gene). None of the above. It is translated in the cytoplasm.

None of the above.

What is the difference between a polynucleotide and an oligonucleotide?

Oligonucleotides, such as RNA, are shorter molecules, containing about 20 nucleotide monomers, while polynucleotides, such as DNA, are longer and are, in fact, the longest polymers in the living world. Some DNA molecules in humans contain hundreds of millions of nucleotides. Oligonucleotides function as "primers" and begin the duplication of DNA process. The functions of polynucleotides are many, including coding for genes

The base content of a sample of DNA is as follows: A = 31%, G = 31%, T = 19%, and C = 19%. What conclusion can be drawn from this information?

The sample of DNA is single-stranded.

The primary structure of a protein is determined by pleated sheets. a series of helical domains. the sequence of amino acids. hydrogen bonds formed between the components of the peptide linkage. covalent bonds formed between fibroin residues.

The sequence of amino acids

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? The tRNA that was in the A site moves to the E site and is released. The tRNA that was in the P site moves into the A site. The tRNA that was in the A site moves into the P site. The tRNA that was in the A site departs from the ribosome via a tunnel.

The tRNA that was in the A site moves into the P site.

DNA replication is semi-conservative in that The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication. DNA replication can only follow the replication fork on the leading strand. The two stands of the original helix are conserved, but they become part of separate progeny DNAs. The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved.

The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

DNA replication is semi-conservative in that The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved. The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication. DNA replication can only follow the replication fork on the leading strand. The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

A base at the first position of an anticodon on the tRNA would pair with a base at the ________ position of the mRNA.

Third

Why does DNA polymerase III exist as a dimer?

This enzyme has two enzymatic activities. Its 5′→3′ polymerase activity allows it to add new nucleotides in the 5′→3′ direction. Its 3′→5′ exonuclease activity allows it to remove nucleotides in the 3′→5′ direction, enabling it to correct errors.

List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: • Attachment of snRNP U1 to the 5' splice site • Transesterification reaction at the branch point adenine • Transcription of the DNA template into the pre-mRNA molecule • Recognition and binding the 3' AAUAAA sequence by specific protein factors • Cleavage at the poly(A) site • Addition of the 5' cap • Export to the cytoplasm • Addition of the poly(A) tail • Release of lariat structure • Splicing together of exons

Transcription of the DNA template into the pre-mRNA molecule Addition of the 5' cap Recognition and binding the 3' AAUAAA sequence by specific protein factors Cleavage at the poly(A) site Addition of the poly(A) tail Attachment of snRNP U1 to the 5' splice site Transesterification reaction at the branch point adenine Release of lariat structure Splicing together of exons Export to the cytoplasm

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication.

primase

Briefly define transformation and describe the relationship between the phenomenon of transformation and the discovery that DNA is the genetic material in bacteria.

Transformation is the process whereby one organism is genetically altered by exposure to DNA from another organism. Since DNA can carry heritable "traits" from one organism to another, it must be the genetic material.

During translation, chain termination is signaled by which triplets? Check all that apply. UGA UAA UAG AUG UGG

UGA UAA UAG

Transcription of the sequence AATGCGGTC would result in: UUACGCCAG TTACGCCAG Not enough information to tell Three amino acids

UUACGCCAG

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? a deoxyribose sugar purine or pyrimidine nitrogen-containing bases a ribose sugar phosphate DNA contains all of the above.

a deoxyribose sugar

In the DNA double helix, disulfide bridges are formed between the two DNA strands a purine always pairs with a pyrimidine None of the above the number of hydrogen bonds between the participating bases is always constant A pairs with G, and T pairs with C

a purine always pairs with pyrimidine.

Given that the origin of replication is fixed in E. coli, what region signals the location of the origin? Give both the name of this region and a description of the sequences present.

a region called ori C which consists of about 250 base pairs characterized by repeating sequences of 9 and 13 bases (9mers and 13mers)

Which is a characteristic of DNA sequences at the telomeres? They consist of cytosine and adenine nucleotides One strand protrudes beyond the other, creating some single-stranded DNA at the end. The consist of repeated sequences all choices are correct

all choices are correct

Which is not true of amino acids? They are the building blocks of proteins tRNA brings them to the ribosome for protein synthesis all of the above are true There are 20 of them required in the body

all of the above are true

In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction. tRNA; P; A; peptidyl-tRNA aminoacyl-tRNA; A; P; ribosome synthetase; P; A; ribosome mRNA; E; P; polymerase

aminoacyl tRNA, A, P, ribosome

The genetic code is said to be triplet, meaning that there are three "nonsense" triplets. there are three amino acids per base in mRNA. there may be three ways in which an amino acid may terminate a chain. there are three bases in mRNA that code for an amino acid. none of these answers

are three bases in mRNA that code for an amino acid

Until about 1970, mitotic chromosomes viewed under the microscope could be distinguished only by their size, positions of centromeres, and "satellites" in some cases. However, various staining techniques have allowed a different view of chromosomes because they allow the visualization of ________.

bands similar to those of polytene chromosomes

In E. coli, which terms accurately reflect the nature of replication of the chromosome? bidirectional and fixed point of initiation bidirectional and multirepliconic unidirectional and fixed point of initiation multirepliconic unidirectional and reciprocal

bidirectional and fixed point of initiation

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. theta replication

bidirectional circular replication

The anticodon on the tRNA molecule: contains amino-acyl-tRNA synthtase. is the same for all tRNA molecules. is a catalytic part of protein synthesis. is oriented and written in the 5'→ 3' direction. binds to the mRNA in a complementary fashion.

binds to the mRNA in a complementary fashion.

How do centromeres help control the cell cycle? by inhibiting anaphase until spindle fibers are attached to chromosomes by causing DNA not attached to centromeres to be lostby inhibiting anaphase until spindle fibers are attached to chromosomes by activating cell cycle control genes by inhibiting the S phase until the cell is ready to double its DNA content

by inhibiting anaphase until spindle fibers are attached to chromosomes

The concept that genetic information passes from DNA to RNA to protein is called

central dogma

In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? ribosomes and DNA uncharged tRNAs and ribosomes charged tRNA, RNA triplet, and ribosome free tRNAs sense and antisense strands of DNA

charged tRNA, RNA triplet, and ribosome

What is the name given to the three bases in a messenger RNA that bind to the anticodon of tRNA to specify an amino acid placement in a protein? codon anti-anticodon cistron protein rho

codon

Heterochromatin is characterized by all of the following, EXCEPT that it is present all over the inactive X chromosomes in mammals. remains highly condensed throughout the cell cycle. is present on most of the Y chromosome. is present at centromeres and telomeres. contains genes that require high levels of transcription.

contains genes that require high levels of transcription.

Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon? use of different transcriptional activators. differential acetylation of specific histone proteins prior to transcription. differences in pre-mRNA splicing that results in an altered pattern of exon inclusion. All of the above. multiple random mutations within specific exons of the gene.

differences in pre-mRNA splicing that results in an altered pattern of exon inclusion.

Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes? double-stranded, parallel, (A + T)/C + G) = 1.0, (A + G)/(C + T) = 1.0 double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C + T) = variable double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0 double-stranded, parallel, (A + T)/C + G) = variable, (A + G)/(C + T) = 1.0 single-stranded, antiparallel, (A + T)/C + G) = 1.0, (A + G)/(C + T) = 1.0

double-stranded, antiparallel, (A + T)/ (G + C) = variable, (A + G)/ (C + T) = 1.0

A procedure that is often used to separate molecules by using their molecular charges is called ________.

electrophoresis

A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will encode unformylated methionine. encode N-formylmethionine. serve as the initiation codon. encode methionine that will eventually be removed.

encode unformylated methionine

That some organisms contain much larger amounts of DNA than are apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in the "alphoid" rather than the diphloid family. eukaryotes than in prokaryotes. RNA viruses than in DNA viruses. prokaryotes than in eukaryotes. viruses than in bacteria.

eukaryotes than in prokaryotes.

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes fusion into circular forms known as plasmids excision of introns union with ribosomes linkage to histone molecules

excision of introns

If one compares the base sequences of related genes from different species, one is likely to find that corresponding ________ are usually conserved, but the sequences of ________ are much less well conserved. introns; chaperons introns; proteins introns; exons chaperons; exons exons; introns

exons, introns

Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes? fixed point of initiation, bidirectional, semiconservative fixed point of initiation, unidirectional, conservative fixed point of initiation, bidirectional, conservative random point of initiation, unidirectional, semiconservative random point of initiation, bidirectional, semiconservative

fixed point of initiation, bidirectional, semiconservative

What is the function of peptidyl transferase activity? It charges tRNAs. It acetylates the end of a protein after translation. It cleaves the polypeptide from the last tRNA during termination. It forms peptide bonds. It moves ribosomes along mRNA during translation.

forms peptide bonds

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary? Z-DNA double helix hairpin B-DNA

hairpin

Chromatin of eukaryotes is organized into repeating interactions with protein octomers called nucleosomes. Nucleosomes are composed of which class of molecules? nonhistone chromosomal proteins glycoproteins lipids histones H1 histones

histones

In eukaryotic replication, there is another fundamental level of complexity because of what proteins?

histones

Considering the structure of double-stranded DNA, what kinds of bonds hold one complementary strand to the other? hydrogen hydrophobic and hydrophilic ionic covalent van der Waals

hydrogen

The relationship between codon and anticodon can be characterized as involving ________ between complementary bases (usually) in typical ________ fashion. hydrogen bonds, parallel covalent bonds, antiparallel hydrogen bonds, antiparallel covalent bonds, parallel ionic bonds, antiparallel

hydrogen bonds, antiparallel

DNA polymerase I is thought to add nucleotides on single-stranded templates without need for an RNA primer. in a 5' to 5' direction. to the 3' end of the primer. in the place of the primer RNA after it is removed. to the 5' end of the primer.

in the place of the primer RNA after it is removed

In the formation of nucleosomes, one histone class, H1, is not directly involved, yet it does associate with DNA to form higher level chromosomal structures. Where does this histone (H1) associate?

in the spaces between nucleosome/DNA complexes

Considering the types of side chains on amino acids and their relationship to protein structure, where are the amino acids with hydrophobic side chains most likely to be located?

inside the protein

The spliceosome is a large enzyme that catalyzes removal of specific introns in pre-mRNAs. junk sequences in the DNA by splicing different parts of a gene. None of the above. sequences in either a DNA or an RNA amino acid sequences in the protein by splicing different parts of a protein.

introns in pre-mRNAs.

Which of the following two terms relates most closely to split genes? heteroduplex, homoduplex elongation, termination 5'-cap, 3'-poly-A tail transcription, translation introns, exons

introns, exons

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promotor

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? It modifies histones so that nucleosomes can be removed from DNA for transcription. It bends and partly unwinds DNA at a promoter. It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. It blocks access of RNA polymerase to the promoter, until removed by general transcription factors.

it bends and partly unwinds DNA at promoter

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. Okazaki fragments

lagging strand

This new strand of DNA has its 3' end oriented in the opposite direction as that in which the replication fork travels.

lagging strand

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. continuous synthesis

leading strand

All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one? mRNA Methionine tRNA Initiation factors

mRNA

Which of the following statements best describes the messenger RNA? mRNA molecules have a double-helix structure mRNA consists of an anti-codon and an amino acid mRNA is the only type of RNA that carries DNA's protein building instructions mRNA is synthesized by ribosomes in the endoplasmatic reticulum genetic information is permanently stored in mRNA

mRNA is the only type of RNA that carries DNA's protein building instructions

The relationship between a gene and a messenger RNA is that genes are made from mRNAs. messenger RNA is directly responsible for making Okazaki fragments. mRNAs make proteins, which then code for genes. all genes are made from mRNAs. mRNAs are made from genes.

mRNAs are made from genes.

List 2 types of small RNA molecules involved in gene regulation.

microRNA (miRNA) and small interfering RNA (siRNA

The finding that virtually all organisms use the same genetic code provides the basis for declaring that the code is universal. Name one exception to such universality.

mitochondrial DNA

Assume that a base addition occurs early in the coding region of a gene. Is the protein product of this gene expected to have more or fewer (state which) altered amino acids compared with the original gene with a base deletion late in the coding region?

more

Which of the following statements about the genetic code are true? There is only one codon for each amino acid The code is ambiguous but not redundant None of the above Most amino acids are encoded by more than one codon Two consecutive bases specify an amino acid

most amino acids are encoded by more than one codon

The basic structure of a nucleotide includes the following components: amino acids. base, sugar, and phosphate. phosphorous and sulfur. mRNA, rRNA, and tRNA. tryptophan and leucine.

nitrogenous base, sugar and phosphate

An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it? 5" ACU3' 5'AUC3" none 5'ATT3'

none

Regarding the structure of DNA, the covalently arranged combination of a deoxyribose and a nitrogenous base would be called a monophosphate nucleoside. nucleotide. ribonucleotide. oligonucleotide. nucleoside.

nucleoside

Three posttranscriptional modifications often seen in the maturation of mRNA in eukaryotes occur in which cellular organelle? cytoplasm Golgi lysosome mitochondrion nucleus

nucleus

The code is nonoverlapping, meaning that, assuming "standard translation" a given base participates in the specification of _________ amino acid(s).

one an only one

The term peptidyltransferase relates to peptide bond formation during protein synthesis. 5' capping of mRNA. elongation factors binding to the large ribosomal subunit. discontinuous strand replication. base additions during mRNA synthesis.

peptide bond formation during protein synthesis.

The bonds that connect nucleotides in the backbone of a DNA strand are called _________bonds.

phosphodiester

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. DNA ligase

phosphodiester bonds at DNA nicks

Hershey and chase labeled DNA using this radioactive atom.

phosphorus

Side groups of amino acids are typically grouped under which of the following? primary, secondary polar, nonpolar alpha, omega long, short linear, circular In eukaryotes,

polar, nonpolar

Which of the following is not a component within a single nucleotide of a nucleic acid? nitrogenous base sugar polymerase phosphate

polymerase

What enzyme is exploited to produce synthetic mRNAs? polynucleotide phosphorylase RNA polymerase II ligase polynucleotide kinase

polynucleotide phosphorylase

The DNA replication enzyme that most closely resembles RNA polymerase is DNA polymerase I. primase. telomerase. DNA polymerase III. helicase.

primase

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. DNA gyrase

supercoil removal

As unwinding of the helix occurs during DNA replication, tension is created ahead of the replication fork. What is the term for the nature of this tension? What enzyme resolves this tension?

supercoiling DNA gyrase

Codons that specify the same amino acid are said to be _________________.

synonymous

Reverse transcriptase is an enzyme found in association with retroviral activity. It has the property of translation. most lysozymes. synthesis of DNA from an RNA template. synthesis of RNA from a DNA template. requiring no template.

synthesis of DNA from an RNA template

Of the following three types of nucleic acids-DNA, mRNA, tRNA-which is most likely to contain modified bases?

tRNA

What are the three classes of "functional" RNAs (not including mRNA)? Briefly describe the role of each class of functional RNA.

tRNA -- brings the correct amino acid to the mRNA during translation. rRNA -- major component of ribosomes. snRNA -- helps process RNA transcripts (especially, helps remove introns).

To translate a mRNA you require two other RNAs. These are

tRNA and rRNA

Structures located at the ends of eukaryotic chromosomes are called centromeres. recessive mutations. telomerases. permissive mutations. telomeres.

telomeres

What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence? that DNA was the genetic material that DNAse or protease, but not RNase, stimulates transformation that protein was the genetic material that RNA was the genetic material

that RNA was the genetic material

What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli. that somehow the radioactivity prevented DNA from getting into E. coli that DNA was the genetic material in phage that protein was the genetic material in phage that protein and DNA together made up the genetic material

that protein was the genetic material in phage

When scientists were attempting to determine the structure of the genetic code, Crick and co-workers found that when three base additions or three base deletions occurred in a single gene, the wild-type phenotype was sometimes restored. These data supported the hypothesis that there are three amino acids per base. the code is triplet. the code contains internal punctuation. the code is overlapping. AUG is the initiating triplet.

the code is triplet

The antiparallel nature of DNA refers to the formation of hydrogen bonds between bases from opposite strands the pairing of bases on one strand with bases on the other strand its charged phosphate groups the opposite direction of the two strands of nucleotides.

the opposite direction of the two strands of nucleotides.

When examining the genetic code, it is apparent that there are 44 stop codons because there are only 20 amino acids. AUG is a terminating codon. there can be more than one codon for a particular amino acid. the code is ambiguous in that the same codon can code for two or more amino acids. there can be more than one amino acid for a particular codon.

there can be more than one codon for a particular amino acid

This Greek letter describes the shape of a bacterial chromosome mid-way through replication.

theta

The role of tRNA is: to serve as general translational components of the ribosome. to facilitate splicing of pre-messenger RNAs. to act as transporters bringing amino acids to the site of protein synthesis. to serve as an intermediate in the decoding of genes. to facilitate splicing of pre-messenger RNAs.

to act as transporters, bringing amino acids to the site of protein synthesis.

DNA polymerase III adds nucleotides to both ends of the RNA primer. to the 3' end of the RNA primer. to internal sites in the DNA template. to the 5' end of the RNA primer. in the place of the primer RNA after it is removed.

to the 3' end of the RNA primer

DNA polymerase III adds nucleotides to the 3' end of the RNA primer. to both ends of the RNA primer. to internal sites in the DNA template. in the place of the primer RNA after it is removed. to the 5' end of the RNA primer.

to the 3' end of the RNA primer

In eukaryotes, tRNAs are transcribed in the nucleus, but function in the cytoplasm. transcribed in both the nucleus and the cytoplasm, and function in the cytoplasm. transcribed in the nucleus, and function in the nucleus. transcribed in the cytoplasm, and function in the cytoplasm.

transcribed in the nucleus, but function in the cytoplasm

In prokaryotes, translation of an mRNA is coupled to None of the above transcription mRNA processing mRNA splicing nuclear export

transcription

What is the name of the precursor molecule used in nucleic acid synthesis (do not give an abbreviation)?

triphosphonucleoside

Match the term with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication Enter only the letter of your choice. rolling-circle replication

unidirectional replication

The genetic code is fairly consistent among all organisms. The term often used to describe such consistency in the code is universal. overlapping. none of these terms. exceptional. trans-specific.

universal

The β chain of adult hemoglobin is composed of 146 amino acids of a known sequence. In comparing the normal β chain with the β chain in sickle cell hemoglobin, what alteration is one likely to find? extensive amino acid substitutions trinucleotide repeats glutamic acid replacing valine in the first position valine instead of glutamic acid in the sixth position frameshift substitutions

valine instead of glutamic acid in the sixth position

The secondary structure of a protein includes the following elements: disulfide bridges. gamma and delta. hydrophobic clusters. alpha and gamma. α-helix and β-pleated sheet.

α-helix and β-pleated sheet.