study island biology

. DDT (dichlorodiphenyltrichloroethane) is a manmade pesticide that was designed to kill insects that carried diseases. However, the pesticide was found to cause mutations to both body cells and sex cells in other organisms. Because of this, DDT is now banned in most countries around the world.How are mutations to reproductive cells, or gametes, different than mutations to other cells in the body? I.Mutations to reproductive cells can be passed on to offspring. II.Mutations to body cells can be passed on to offspring. III.Mutations to body cells are more harmful than mutations to reproductive cells. IV.Mutations to reproductive cells are usually beneficial to offspring.

I only

. Chromosomes contain genes, and genes determine an organism's characteristics. Sometimes mutations occur in which the sequence of nucleotides within a gene becomes altered. Which of the following describes how a gene mutation would most likely affect an organism?

It would cause different proteins to be produced during translation.

A researcher is investigating a short DNA segment within a gene. When translated, the DNA segment produces a peptide chain with the sequence Met-Ala-Pro-Gly-Ser. The researcher has identified an insertion mutation that changes this segment of DNA to the segment given.Mutated DNA segment:3′-TAC CCG AGG GCC TTC-5′mRNA Codon Chart Image courtesy of NIH According to the mRNA codon chart, what is the sequence of the peptide chain produced when the mutated DNA segment is translated?

Met-Gly-Ser-Arg-Lys

A scientist shines low levels of ultraviolet radiation on a dish containing colonies of ruby-red bacteria. He then makes several replicate plates from this dish over many generations. He finds that in addition to the ruby-red color, there are also pink, orange, and yellow bacteria.

Mutations occurred in the gene for color and were passed on to successive generations of bacteria.

The table below lists several well-known diseases.Disease Cause Sickle-cell anemia inheritance of a recessive mutated gene Herpes Virus transmitted through skin to skin contact Huntington's disease inheritance of a dominant mutated gene Down's syndrome Meiosis error resulting in an extra 21st chromosome Cancer Non-transmittable genetic mutation Measles Virus transmitted through body fluids Plague Bacterial infection spread by fleas According to the chart, which diseases result from inherited changes in DNA sequence?

Sickle-cell anemia and Huntington's diseased

The codon chart relates amino acids to the mRNA codons that specify them. mRNA Codon Chart Image courtesy of NIH A DNA triplet has the sequence 3′-ATC-5′. After a single base mutation, the DNA triplet produces an mRNA codon that specifies the amino acid tryptophan (Trp).

The nucleotide T was replaced with C.

Dr. Stevens is examining the DNA sequences of a group of mice. He notices that in one of the mice, one nucleotide has been substituted with another in the part of the DNA sequence that codes for fur color. However, despite the substitution, the mouse still has the same fur color as the other mice that have the typical DNA sequence.

The substituted nucleotide produces codons that correspond to the same amino acid that is found in the other mice.

Mutations can occur randomly during DNA replication. Suppose DNA replication is occurring in a cell. If DNA replication occurs correctly, the following strand will be produced.If a substitution mutation occurs during DNA replication, which of these could represent the mutated strand produced instead? atg-gac-cat-ttc-ggc

atg-gac-cat-ttc-agc

Mutations can occur randomly during DNA replication. Suppose DNA replication is occurring in a cell. If DNA replication occurs correctly, the following strand will be produced.If a point mutation occurs during DNA replication, which of these could represent the mutated strand produced instead? atg-gac-cat-ttc-ggc

atg-gac-ctt-ttc-ggc

. A mutation occurs in a brain cell. This mutation will be passed on to

cells produced when the mutant cell divides

. A mutation in a bacteria cell changes the gene that codes for a certain protein, and as a result the bacteria produces a different protein. The gene sequences before and after the mutation are shown in the table below.Sequence before the mutation:A-T-A-G-G-C-G-G-C-T-A-GSequence after the mutation:A-T-A-G-G-C-T-A-GWhat type of mutation caused the cells to start making a different protein?

deletion

DNA mutations can lead to genetic disorders, diseases, or even the death of an organism. Which of the following factors is most likely to cause a mutation in DNA?

exposure to toxic chemicals

Atrazine is one of the most widely used herbicides throughout the world. Some studies have shown that the chemical has affected the sexual development of frogs, most notably, leopard frogs (Rana pipiens).One study suggested that male tadpoles exposed to the herbicide develop into female frogs. These mutated female frogs, according to the study, have the ability to reproduce with other males. However, the mutated frogs can only produce male

factors in the environment can change the characteristics of organisms.

Gametes in humans are haploid. This means that they have half the number of chromosomes as normal body cells. Sometimes, the gamete of a male and the gamete of a female combine to form a zygote that will eventually turn into a fetus.Phenotypic changes in a fetus may result

if a mutation occurs in the gametes.

Sickle cell anemia is a genetic disorder obtained from

inheriting a mutation in the DNA sequence of a particular gene.

mutation in a plant's cell changes the gene that codes for a certain protein, and as a result the cell can no longer make the protein. The gene sequences before and after the mutation are shown in the following table. Sequence before the mutation:A-T-T-A-T-C-A-T-A Sequence after the mutation:A-T-T-T-A-G-A-T-C-A-T-A What kind of mutation is shown in the table?

insertion

Body cell mutations cannot be passed on to offspring. This is because body cells do not contribute genetic material to

non-mutant cells

When changes occur in a DNA sequence, _______ produced from the DNA may not function correctly, and a _______ disease may result.

proteins, genetic

A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and their corresponding amino acids.Amino Acid DNA Codon(s)Alanine GCT, GCC, GCA, GCGArginineAGA, AGG, CGT, CGC, CGA, CGG Asparagine AAT, AAC aspartic Acid GAT, GACCysteineTGT, TGC Glutamic Acid GAA, GAGGlutamineCAA, CAGGlycineGGT, GGC, GGA, GGGHistadineCAT, CAC Isoleucine ATT, ATC, ATALeucineCTT, CTC, CTA, CTG, TTA, TTG Lysine AAA, AAG Methionine (Start)ATG Phenylalanine TTT, TTCProlineCCT, CCC, CCA, CCGSerineTCT, TCC, TCA, TCG, AGT, AGC Threonine ACT, ACC, ACA, ACG Tryptophan TGG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTGStopTAA, TAG, TGA In the DNA strand below, two nucleotides were reversed during replication. What will happen when the replicated DNA strand is translated into a protein?

Tyrosine will be added instead of isoleucine.

Sickle-cell anemia is a genetic disorder in which red blood cells take on an abnormal crescent shape.People who do not have sickle-cell anemia possess the following nucleotide and amino acid sequences: CTGACTCCTGAGGAGAAGTCTLeuThrProGluGluLysSer People who do have sickle-cell anemia possess the following nucleotide and amino acid sequences: CTGACTCCTGTGGAGAAGTCTLeuThrProValGluLysSer Sickle-cell anemia is an example of

a gene mutation

______ is a source of genetic variation that refers to a random error in the genetic code.

a mutation