Bio 111 Ch. 16 T3

Elongation (2nd step of translation)

-Amino acids added to preceding amino acids -

Initiation (1st step of translation)

-Brings mRNA together -add 2 subunits of a ribosome -tRNA has first amino acid of polypeptide

DNA anti-parallel structure

-Causes nucleotides to add only at 3' end causing asymmetry at fork -One side is continuously synthesized and the other is discontinuous

Transfer RNA (tRNA)

-Charged with right amino acid -Recognizes codon and complementary base pairs -assume 1 tRNA per each sense codon

DNA replication

-Copying DNA, fast and accurate -more than 12 enzymes are involved

Priming DNA Synthesis

-DNA plymerases can't initiate synthesis of a polynucleotide, can only add nucleotides to 3' end -Initial nucleotide strand is an RNA primer in cells

Bacterial chromosomes

-Double stranded, circular DNA, some protein -nucleoid contains supercoiled DNA

Termination (3rd step of translation)

-Final stage, ribosome reaches a stop codon in mRNA and release factor binds -RF causes release of polypeptide chain and diassembles ribosome

Challenges

-Separate strands helicase -Getting started, priming b/c you need an OH on the 3' which comes from a primer

Capping

-after RNA synthesis begins -Add on a nucleotide to 5' of new RNA -GMP added in reverse orientation -added by capping enzyme -Molecule can't leave nucleus without cap

Ribosome

-makes proteins -facilitates coupling of tRNA anticodons with mRNA during protein synthesis

Translation

-ribosome has 3 binding sites for tRNA -P site - Peptidyl-tRNA binding site -A site - aminoacyl tRNA binding -E site - exit

Given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have? 12 10 9

11

Which sequences is complementary to a DNA strand with sequence: 5' -TCCGAGCTACGTT- 3'?

3'-AGGCTCGATGCAA-5' (flip, write 5' to 3')

Suppose you feed radioactive dTTP to bacteria for 2 generations. Then you isolate the DNA from the bacterium. If you denature the double stranded DNA and measure the radioactivity in the single strands, the fraction of single strands containing radioactivity will be ____ all 7/8 3/4 5/8 1/2 3/8 1/4 1/8 none

3/4

Which of the following sequences is complementary to the DNA strand with sequence: 5'-TCCGAGCTA- 3'? 5' -TAGCTCGGA- 3' 5' -AGGCTCGAT- 3' X 3' -ATCGAGCCT- 5' 3' -TCCGAGCTA- 5'

5' -TAGCTCGGA- 3'

Which sequence is complementary to a DNA strand with sequence: 5' -TCCGAGCTACGTT- 3'?

5'-AACGTAGCTCGGA-3'

Which of the sequences can fully base-pair with itself? 5'-AAGCCGAA-3' 5'-AAGCCGTT-3' 5'-AAGCGCAA-3' 5'-AAGCGCTT-3'

5'-AAGCGCTT-3'

Suppose a section of DNA reads: 5'-GTAGCCTACCCATAGG-3' Suppose mRNA is made using the complementary strand as template. What peptide will be made if translation starts right at the 5' end? (Assume no start codon) Express your answer using the three letter aa code with no spaces. ex AlaProGlyGln etc. CAUCGGAUGGGUAUCC HisArgMetGlyIle ProMetGlyArgLeu

5'-CCUAUGGGUAGGCUAC 3'-GGAUACCCAUCCGAUG-5' AspAlaTyrPro

The figure above shows a tRNA molecule. What is the codon sequence that this tRNA molecule will bind to?

5'-UUC-3'

The A+T/G+C ratio of the DNA of Bacillus quizzencis is 1.5. Therefore the % of C residues in the DNA is _______? 33% 67% 40% 20% can't tell from information given.

67%

Enhancer

A DNA sequence that can stimulate transcription of nearby genes. -Made of distal control elements (short DNA seq.)

Lagging strand

A discontinuously synthesized DNA strand that elongates by means of Okazaki fragments that join by DNA ligase. Each synthesized in a 5' to 3' direction away from the replication fork.

Polyribosome (polysome)

A group of several ribosomes attached to, and translating, the same messenger RNA molecule.

If the percentage of guanine in E.coli is 26%, then the percentage of other nitrogenous bases would be: Adenine=24%, Thymine=24%, Cytosine=26% Adenine=26%, Thymine=24%, Cytosine=26% Adenine=48%, Thymine=48%, Cytosine=26% X Adenine=26%, Thymine=24%, Cytosine=24%

Adenine=24%, Thymine=24%, Cytosine=26%

Negative regulation of lac operon

Allolactose binding to repressor because it removes repressor from DNA so gene expression is encouraged

Humans contain about 20,000 genes but can make 75,000- 100,000 different proteins. The most likely explanation for this is:

Alternative splicing of exons

Transcription factor TFIID

Binds to TATA box to recruit transcription factors to form a complex. RNA polymerase binds to upstream seq and is phosphorylated. now ready for transcription

Pre-mRNA

Can be alternatively spliced to create proteins (in nucleus)

Eukaryotes

Cells that contain nuclei -Have hundreds or thousands of replication origins per chromosome

Nucleosome complex

DNA folded around histone proteins, control access of proteins to underlying DNA -When too close together, transcription cannot bind and gene expression is turned off -When too far apart, DNA is exposed and gene expression occurs

Regulatory sites

DNA sequences, activator binding sites recognized by activator proteins

DNA replication is semiconservative in nature because: a) Each new double-stranded DNA helix contains one completely old strand and one completely new strand. b) Each strand of both daughter molecules contain a mixture of old and newly synthesized DNA. c) The two parental strands reassociate after acting as templates for new strands, restoring parental double helix. d) Half of a newly synthesized DNA molecules comes from one parent and the other half from the other parent.

Each new double-stranded DNA helix contains one completely old strand and one completely new strand.

DNA polymerase

Enzyme involved in DNA replication that joins individual nucleotides to produce a DNA molecule -Adds nucleotides to 3' end

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following?

Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

Eukaryotic chromosomes

Linear DNA molecules with a large amount of protein -must be condensed into compact chromosomes to fit into nucleus

poly A tail

Modified end of the 3' end of an mRNA molecule -Poly-A polymerase is RNA

mRNA modifications

Must be modified to become mature mRNA -Addition of a 5′ methylguanosine cap: Protects from degradation; involved in translation initiation -Addition of a 3′ poly-A tail: created by poly-A polymerase; protection from degradation -Removal of non-coding sequences (introns): pre-mRNA splicing done by spliceosome

Prokaryotes

No nucleus cells, single origin or replication

Regulatory proteins

Proteins rexognize and bind to DNA sequences

How does RNA polymerase differ from DNA polymerase? All

RNA polymerase can initiate RNA synthesis de novo (from scratch), while DNA polymerase requires a primer to initiate DNA synthesis.

Which property of genetic code lowers the chances of a deleterious mutation in an individual?

Redundancy

Which property of genetic code lowers the chances of a deleterious mutation in an individual? Hydrogen bonding All

Redundancy

In DNA replication the enzyme primase is used to attach a 5 to 20 base ribonucleotide strand complementary to the parental DNA strand. The RNA strand serves as a starting point for the DNA polymerase that replicates the DNA. If a mutation occurred in the primase gene, which of the following results would you expect?

Replication would not occur on either leading or lagging strand b/c primase has to be made successfully

Extrons

Sequences of RNA that are translated into proteins

Spliceosomes

Special molecules that assist in the editing of mRNA during RNA processing.

The nucleotide shown does not exist in the cell as it has a mismatched base and sugar. To correct it you would have to change

The base to T

Consider the DNA sequence AATCTAGGCTAACTGGAGTCA Assume this DNA is written in the usual convention, and that it is part of a longer, double-stranded, DNA molecule. Now suppose the DNA is transcribed from left to right. Write out the RNA that will be made using the standard convention.

UGACUCCAGUUAGCCUAGAUU

Lac operon repressed

When lactose is absent...repressor binding to lac operators blocks RNAP from binding to lac promoter

Nucleus supports...

Where Eukaryotic transcription and RNA processing happens (translation)

The following figure shows a replication bubble. The correct labeling for this figure is:

a- origin of replication; b- leading strand; c- lagging strand; d- Okazaki fragment; e- RNA primer

Positive regulation of lac operon

cAMP and CRP binding to promoter because it encourages gene expression

The figure below shows different types of point mutations. Identify the type of mutation in each case.

i- no mutation; ii- silent mutation; iii- nonsense mutation; iv- missense mutation

Arrange the events taking place during transcription in eukaryotes in order: i) The pre-RNA undergoes final processing ii) RNA polymerase moves downstream, unwinding the DNA iii) RNA polymerase binds to the promoter iv) RNA transcript is released and polymerase detaches from the DNA v) Polymerase initiates RNA synthesis at the start point on the template strand a) v, ii, i, iii, iv

iii, v, ii, iv, i

Give below is a list of events taking place during translation. Arrange these in proper sequence. i) The anticodon of tRNA base pairs with the mRNA codon at the A site ii) Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site iii) Translocation of tRNA from the A site to the P site iv) A small ribosomal subunit binds with mRNA

iv, i, ii, iii

lac operon expressed

lactose is present

How do the leading and the lagging strands of DNA replication differ?

leading strand is synthesized in the same direction as the movement of the replication fork and the lagging strand is in the opposite direction

Suppose a section of DNA reads: 5'-GTAGCCTACCCATAGG-3' Suppose mRNA is made using the complementary strand as template. What peptide will be made if translation starts right at the 5' end? (Assume no start codon is needed; this is true under certain test tube conditions). a) ProMetGlyArgHis b) HisArgMetGlyIle

mRNA 3'-CAUCGGAUGGGUAUCC-5' HisArgMetGlyIle

What happens in Prokaryotes?

mRNA encodes more than one protein -lactose operon is located

When an mRNA is being translated, the ribosome with the longest growing peptide chain should be ______.

near the 3' end

A point mutation that changes a codon for an amino acid to a stop codon is called:

nonsense mutation

Activator proteins

positive regulators - proteins that bind to enhancer sequences in eukaryotes to increase transcription

Introns

sequence of DNA that is not involved in coding for a protein and are tossed out -allows for alternative RNA splicing

DNA polymerase III

synthesizes new DNA only in the 5' to 3' direction, moves toward replication fork

A growing polypeptide should be covalently attached to ______.

tRNA