Ch 2/25.1 Questions

A Tt pea plant is crossed with a tt pea plant. What is the expected ration of phenotypes for offspring with this cross?

1 tall : 1 dwarf

Match the description of transmission of the disease with the pattern of inheritance. Assume full penetrance. Use each answer choice only once. 1. An affected offspring usually has one or two affected parents, and the trait occurs equally in both sexes. 2. Frequently an affected offspring has two unaffected parents, and the trait occurs equally in both sexes. 3. Males are much more likely to exhibit the trait, and mothers of affected males often have brothers or fathers who are affected. 4. Only females exhibit the trait when it is lethal to males, and affected mothers have a 50% chance of passing the trait to daughters.

1. autosomal dominant 2. autosomal recessive 3. X-linked recessive 4. X-linked dominant

Choose true or false for the following statements regarding human genetic diseases. 1. Genetic diseases are spread by shared environmental conditions. 2. Genetic disorders are more common in families with one affected member as compared to the general population. 3. Both members of identical and fraternal twin pairs have the same likelihood of expressing the same genetic disease. 4. Genetic diseases occur at the same rate in all human populations. 5. Most genetic diseases have a specific age of onset. 6. Many human and animal genetic disorders share similar characteristics.

1. false 2. true 3. false 4. false 5. true 6. true

A woman whose father has hemophilia and whose mother does not married a man with hemophilia. What is the probability that they will have a child with hemophilia?

1/2

If the couple from the previous question were to have another child what is the probability that it would have hemophilia?

1/2

A woman whose father has hemophilia and whose mother does not married a man that does not have hemophilia. What is the probability that they will have a child with hemophilia?

1/4

In dogs, brown fur color (B) is dominant to white (b). A cross is made between two heterozygotes. If a litter contains six pups, what is the probability that half of them will be white?

13%, using binomial expansion

When Mendel crossed two plants that were heterozygous for a single trait, what was the genotypic ratio of their offspring?

1:2:1

If a parent is Ttyy, how many different types of gametes can it make?

2 types: Ty, ty in equal amounts

Cystic fibrosis is caused by mutations in the CF gene, and there are several different mutations that are known to result in CF disease. The CF mutations behave as recessive alleles to the WT CF allele. If two carriers that have different mutations in their CF genes have children what is the probability that one of their children will have CF disease?

25%

Huntington's disease is a fatal syndrome caused by a mutation in the HD gene. The disease has an average age of onset of 35 and the majority of individuals that are affected are heterozygotes. What is the probability that a 25-year-old woman with no symptoms and who is the daughter of a man that has HD and a mother who does not will have a child that will have the mutant HD allele?

25%

A cross is made between a pea plant that is RrYy and one that is rrYy. What is the predicted outcome of the seed phenotypes?

3 round, yellow 1 round, green 3 wrinkled, yellow 1 wrinkled, green

When Mendel crossed two plants that were heterozygous for a single trait, what was the phenotypic ratio of their offspring?

3:1

What is the probability that an offspring will have an ss/RR genotype from a cross of two Ss/Rr individuals?

6.25%

Two dihybrid pea plants (both tall and with purple flowers) are mated. The cross resulted in 9866 progeny, of which 5550 were tall with purple flowers. What are the expected ratios of the other phenotypic classes?

616 Short/white flower 1850 Tall/white flower 1850 Short/purple flower

If a Punnett square is used to visualize a three-factor cross (trihybrid cross) how many boxes would be inside of the square?

64

Using Mendel's flower color (purple is dominant, white is recessive), if two heterozygous plants are crossed, what is the probability that the first two offspring will have purple flowers?

9/16

In a dihybrid cross using Mendelian inheritance, if both parents are heterozygous for both traits, what will be the phenotypic ratio of their offspring?

9:3:3:1

Which of the following is not a common explanation for a dominant disorder? a. Haploinsufficiency b. A change in chromosome number c. A gain-of-function mutation d. A dominant-negative mutation

A change in chromosome number

Experimental advantages of using pea plants include which of the following? a. They came in several different varieties.. b. They were capable of self-fertilization. c. They were easy to cross. d. All of the above were advantages.

All of the above were advantages

Experimental advantages of using pea plants include which of the following? a. They came in several different varieties. b. They were capable of self-fertilization. c. They were easy to cross. d. All of the above were advantages.

All of the above were advantages.

In a dihybrid testcross, the individual being examined is crossed to which of the following?

An individual who is homozygous recessive for both traits

Which of the following DNA sequence repeats within the Huntington gene would be associated with the development of HD?

CAGCAGCAGCAGCAGCAGCAGCAG

Which of the following operations could be used for hypothesis testing? a. Product rule b. Binomial expansion c. Chi square test d. All of the above

Chi square test

When studying a genetic cross, the second generation following the initial cross is identified by which of the following?

F2 generation

What was the conclusion from Mendel's two factor crosses?

Genes randomly assort into the gametes

The theory of pangenesis was first proposed by

Hippocrates

What is a feature of a pedigree? Check all that apply.

It represents the relationship between individuals in successive generations; They can be used to deduce if a gene may be sex-linked.

A pea plant is Tt. Which of the following statements is correct? A. Its genotype is Tt, and its phenotype is dwarf. B. Its phenotype is Tt, and its genotype is dwarf. C. Its genotype is Tt, and its phenotype is tall. D. Its phenotype is Tt, and its genotype is tall.

Its genotype is Tt, and its phenotype is tall

Mendel's work with two-factor (dihybrid) crosses led directly to which of the following?

Law of independent assortment

The _____ indicates the probability that differences between the observed values and the expected values are due to random chance alone.

P value

If the progeny of a mating of pea plants have the following ratios 1342 smooth seed/green pod, 447 wrinkled seed/yellow pod, 429 smooth seed/ yellow pod, 1361 wrinkled seed/green pod what are the genotypes of the parents?

Parent 1: Heterozygous for seed shape and pod color Parent 2: Homozygous seed shape and heterozygous for pod color

A cross is made between AA Bb Cc Dd and Aa Bb cc dd individuals. Rather than making a very large Punnett square, which statistical operation could you use to solve this problem, and what would be the probability of an offspring that is AA bb Cc dd?

Product rule, 1/32

With regard to the T and t alleles, explain what the word segregation means

Segregation means that the T and t alleles separate from each other so that a gamete receives one of them, but not both

Which definition below is the best definition for probability?

The chance that an outcome will occur in the future.

Which of the following would not be consistent with the idea that a disorder has a genetic component? a. The disorder is more likely to occur among an affected person's relatives than in the general population b. The disorder can spread to individuals sharing similar environments c. The disorder tends to develop at a characteristic age d. A correlation is observed between the disorder and a mutant gene

The disorder can spread to individuals sharing similar environments

In a population of wild squirrels, most of them have gray fur, but an occasional squirrel is completely white. If we let P and p represent dominant and recessive alleles, respectively, of a gene that encodes an enzyme necessary for pigment formation, which of the following statements do you think is most likely to be correct? a. The white squirrels are pp, and the p allele is a loss-of-function allele b. The gray squirrels are pp, and the p allele is a loss-of-function allele c. The white squirrels are PP, and the P allele is a loss-of-function allele d. The gray squirrels are PP, and the P allele is a loss-of-function allele

The white squirrels are pp, and the p allele is a loss-of-function allele

Which of the following would not be observed in a pedigree if a genetic disorder was inherited in a recessive manner? a. Two unaffected parents have an affected offspring b. Two affected parents have an unaffected offspring c. One affected and one unaffected parent have an unaffected offspring d. All of the above are possible for a recessive disorder

Two affected parents have an unaffected offspring

A couple has four children, two sons and two daughters. One son has hemophilia and the other does not. One daughter has hemophilia and the other is a carrier. What were the genotypes of the mother and the father?

X(H)X(h) and X(H)Y

Which of the following characteristics made the pea plant Pisum sativum an ideal organism for Mendel's studies? a. It has the ability to self-fertilize b. It was easy to cross-fertilize one plant with another c. It has easily identifiable traits

all of the answers are correct

Which of the following is correct regarding the blending hypothesis of inheritance? a. It suggested that hereditary traits blended from one generation to the next. b. It was possible for the blending to change the trait from one generation to the next. c. It was supported by early research by Joseph Kölreuter. d. It was the prevailing hypothesis of inheritance prior to Mendel.

all of the answers are correct

A(an) _______ is a variation of a gene.

allele

Why does independent assortment promote genetic variation?

allows for new combinations of alleles among different genes to be found in future generations of offspring

A couple would like to know what the probability is that out of five children, three will be girls. This is solved using which of the following?

binomial expansion

If an individual that phenotypically has dominant traits is mated to another individual that also has dominant traits and the progeny have both dominant and recessive traits it indicates that

both parents are heterozygotic

What are the two different meanings of horizontal lines in a pedigree?

connect two individuals that have offspring together; connect all of the offspring that are produced by the same two parents

A true breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod plants. All of their offspring have green pods. From this information, it can be stated that the green color is _____ to the yellow color.

dominant

Mendel's work on inheritance had an immediate influence on the scientific community and theories of inheritance.

false

The Chi-square test is used to prove that a hypothesis is correct.

false

The genetic composition of an individual is called its

genotype

Statistical analysis determines the _______ between observed data and what was expected from the original hypothesis.

goodness of fit

In a Punnett square diagram, the outside of the box represents the

haploid gametes

An individual who has two different alleles for a trait is called

heterozygous

An individual who has two identical alleles for a trait is said to be

homozygous

If two individuals with different distinct characteristics are mated, their offspring is called a

hybrid

Locus heterogeneity refers to a genetic disorder that

is caused by mutations in two or more different genes

Mendel's work with single-factor crosses resulted in the development of which of the following?

law of segregation

In the biological sciences, the null hypothesis is usually rejected if the P value is

less than 0.05

A geneticist cannot make sense of a pedigree he has put together for a newly discovered disease that he suspects is transmitted genetically. One possible explanation is

locus heterogeneity

An allele that produces an inactive enzyme would be classified as what kind of allele?

loss of function

What do we mean when we say a strain is true-breeding?

maintains the same trait over the course of many generations

The anther represents the _____ portion of the plant, while the ovules represent the ____ portion of the plant.

male; female

A cross in which a researcher investigates the patterns of inheritance of a single trait is called a

monohybrid cross

In a genetic cross, there are n classes of data. What would the degrees of freedom be for a chi-square test on this data?

n-1

In a genetic cross, the _______ represent offspring with genetic combinations that were not found in the parental lines.

nonparentals

The study of family trees in humans is called a _______ analysis.

pedigree

In humans, patterns of inheritance are often studied using which of the following?

pedigree analysis

The observable characteristics of an organism are called its

phenotype

Which of the following traits was not studied by Mendel?

pollen color

Prior to fertilization, where is the male gamete located?

pollen grains

The chance that a future event will occur is called

probability

Which of the following would be used to determine the probability of three independent events in order?

product rule

According to the Law of Segregation allele segregation into gametes is

random

A coin is flipped 100 times, with a result of 53 heads and 47 tails. The deviation between the observed numbers and the expected 50-50 results is called

random sampling error

To avoid self-fertilization in his pea plants, Mendel had to

remove the anthers from immature flowers

The results that demonstrated that traits were not blended were the ones where

the F1 generation plants were self fertilized

The term cross refers to an experiment in which

the gametes come from different individuals

Differences in plant flower color or plant height are called a variant of a trait.

true

If over several generations a trait does not vary in a group of organisms, that group can be called a

true-breeding line

The Law of Independent Assortment states that

two different genes will randomly assort their alleles during the formation of haploid cells.

A young man knows that his grandfather had Huntington disease (genotype Hh). However, his father passed away at the age of 26 without ever being tested or showing signs of HD. Neither the young man's mother nor his grandmother had Huntington disease. What is the probability that this young man will develop HD when he is older?

¼ (The young man's grandparents were Hh and hh. His father had a 50% (1/2) chance of being Hh. If his father was Hh, then his parents were Hh x hh, which would mean he'd have a 50% (1/2) chance of being Hh. 1/2 x 1/2 = ¼.)

A pea plant has the genotype rrYy. How many different types of gametes can it make and in what proportions?

1 rY : 1 ry