Chapter 5 Homework

How many water molecules would be produced in making a polypeptide that is 20 amino acids long?

19

Imagine you are following a particular tRNA, called tRNA^Q, through the process of translation in a eukaryote. Consider the steps of tRNA^Q translation. 1. the polypeptide is transferred to tRNA^Q 2. tRNA^Q binds the A site of the ribosome 3. tRNA^Q binds the P site of the ribosome 4. the ribosome shifts, with tRNA^Q still bond 5. tRNA^Q binds the E site of the ribosome In what order does tRNA^Q go through the steps listed? Note that some steps may be used more than once.

2, 1, 4, 3, 4, 5

How many different types of aminoacyl tRNA synthetases are there?

20

With 20 amino acids, the number of possible polypeptides that include exactly 10 amino acids is:

20^10

An mRNA molecule has a sequence 5' - CAGAUCUAAUGCUUAAUCGGAU - 3' When translated in a laboratory setting where translation can be initiated anywhere along the molecule, how many reading frames are possible?

3

Use the table to answer this question. If the RNA transcript 5' - AUGAUCGGAUCGAUCCAU - 3' resulting from the DNA sequence is present in the mRNA and translated codon by codon from one end to the other, which of the polypeptides would correspond to this part of the mRNA?

NH2 - Met - Ile - Gly - Ser - Ile - His - COOH

Which of the environmental factors affect the interactions between amino acids that in turn determine the shape of a protein?

all of these choices are correct

Imagine that a scientist is able to travel back in time to when the first proteins appeared. What would she observe?

all proteins would be relatively short

During translation, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal sequences. Which sequence would you expect to find in the signal sequence that will eventually become enzymes important in photosynthesis?

an amino-terminal signal sequence

Consider the figure shown. Using the genetic code, select the correct amino acid from the answer bank to complete the growing polypeptide chain shown in the depicted figure.

answer is the photo

Determine the total number of α carbons, peptide bonds, and hydrophilic and hydrophobic amino acids in the given primary sequence. Indicate your answer by selecting the correct number from the answer bank to place into each of the empty boxes. Numbers may be used once, more than once, or not at all.

answer is the picture

In a protein-coding region of DNA, a mutation that replaces a single nucleotide, but does not change the resulting amino acid, is likely to be:

at the 3' position in a codon of the transcribed mRNA

Proteins that prevent inappropriate folding of newly synthesized proteins are called:

chaperones

The bond that forms between amino acids

connects amino groups and carboxyl groups of adjacent amino acids

The unfolding of a protein by heat or chemical treatment is referred to as:

denaturation

Secondary structure is characterized by which type of interactions?

hydrogen bonding within the peptide backbone

Where must the SRP receptor be located in a cell?

in the membrane of the rough endoplasmic reticulum

Select all the mechanisms from the answer bank that would contribute to the evolution of an amino acid sequence. Place the selected mechanism(s) into the empty box to indicate your answer.

mutation; selection

During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence or absence of short sequences of amino acids called signal peptides. Which peptide would you expect to find in the polypeptides that will eventually fold to become the cytoskeletal proteins tubulin and actin, which are found in the cytoplasm?

no signal peptide

Translation of a protein destined to function in the nucleus occurs:

on free ribosomes in the cytosol

The three- dimensional shape of a protein is determined by the primary, secondary, tertiary, and, in many cases, quaternary structure of the protein, all of which are listed in the answer options. The following sentence is taken from a scientific article on protein structure. Select the level of protein structure from the list of options. Peptide bonds form between the monomers.

primary

Complex macromolecular structures on which protein synthesis takes place are referred to as:

ribosomes

Specialized cells in the pancreas produce insulin. Insulin is a secreted protein that is important for the regulation of blood sugar levels. Based on this information, insulin is translated in the ________ and packaged into _______.

rough ER; secretory vesicles

The three-dimensional shape of a protein is determined by the primary, secondary, tertiary, and, in many cases, quaternary structure of the protein, all of which are listed in the answer options. The sentence is taken from a scientific article on protein structure. Select the level of protein structure from the list of options. There are extensive ionic interactions between positively charged R groups and negatively charged R groups on the polypeptide.

tertiary

Suppose that a primary RNA transcript from a eukaryotic gene was processed incorrectly and had no 5' cap. What outcome could you predict?

the initiation complex for translation would fail to form properly, and translation would not occur

Which of the processes occur in the cytoplasm of eukaryotic cells?

translation only

Members of a protein family often contain the same folding domain.

true

Regardless of the amino acid to be bound to a tRNA molecule, all tRNA molecules use the same sequence at their 3' end to serve as the amino acid attachment site.

true

Sixty-one of the 64 possible codons specify an amino acid, whereas the other 3 are stop codons. Each of the 61 codons specifies just one amino acid.

true

The codons in mRNA specify the amino acids that are used to make a protein. Some amino acids are specified by just one codon, whereas others are specified by multiple codons.

true

After translation has been initiated, how long will elongation continue?

until the ribosome reaches a UAA, UAG, or UGA codon

A mutation takes place in a protein-coding gene that changes one codon, resulting in single amino acid replacement. Which type of replacement is least likely to result in a disruption of protein structure and function?

a polar amino acid to a polar amino acid

Transmembrane proteins must have:

a signal sequence and a signal-anchor sequence