Genetics Chapter 25 (medical genetics)

How can abnormal forms of the prion protein arise within an individual?

-A person can be infected by eating meat from an animal with the disease -A person may have inherited an allele that causes their normal prion protein to convert to an abnormal one at a low rate

human diseases that are inherited in an X-linked recessive fashion

-Androgen insensitivity syndrome -Duchenne muscular dystrophy -Hemophilia A

human disorders inherited in an autosomal dominant fashion

-Aniridia -Marfan syndrome -Huntington disease

Concordance

-Degree to which twins share a trait. -Theoretically, for diseases caused by a single gene, concordance among identical twins should be 100%

Which of the following statements about PrPC is true?

-It is encoded by a cellular gene -It is rich with alpha-helices -It is converted by PrP^Sc into a disease-causing form

Colorblindness is an X-linked recessive trait. A phenotypically normal man and a colorblind woman have four sons. What is the probability that all four of them are color blind? Assume no new mutations.

1/1

A woman whose father has hemophilia and whose mother does not married a man with hemophilia. What is the probability that they will have a child with hemophilia?

1/2

If the couple from the previous question ( 64) were to have another child what is the probability that it would have hemophilia?

1/2

A woman whose father has hemophilia and whose mother does not married a man that does not have hemophilia. What is the probability that they will have a child with hemophilia?

1/4

A young man knows that his grandfather had Huntington disease (genotype Hh). However, his father passed away at the age of 26 without ever being tested or showing signs of HD. Neither the young man's mother nor his grandmother had Huntington disease. What is the probability that this young man will develop HD when he is older?

1/4

Duchenne muscular dystrophy is an X-linked recessive disease. A phenotypically normal couple wants to start a family. The woman's brother has the disease. What is the probability that the couple's first child will be affected?

1/8

In a particular plant, height is under the control of a single gene that has two alleles: the dominant A (Tall) and the recessive a (Dwarf). A cross of two heterozygous tall plants produces 200 offspring, of which 120 are tall. What is the penetrance of the dominant height allele?

80%

An individual with Huntington disease has two normal parents. What are plausible explanations for this pattern of inheritance?

A spontaneous mutation occurred in the father's germline to produce a mutant HD allele.

What can cause prion disease in humans when the products of an affected animal are consumed?

Abnormal form of the prion protein

_______________ involves analysis of amniotic fluid.

Amniocentesis

Type of testing: The enzymatic activity of a protein can be assayed in vitro.

Biochemical

Which of the following DNA sequence repeats within the Huntington gene would be associated with the development of HD?

CAGCAGCAGCAGCAGCAGCAGCAG

Barbara's first son has hemophilia, an X-linked recessive disorder. What is the probability that her next son will be hemophiliac?

Cannot be determined without knowing Barbara's genotype

Which methods can be used at the DNA level to test for specific mutations related to a genetic disease?

DNA sequencing Fluorescence in situ hybridization (FISH) DNA microarray analysis

Which type of mutation causes a dominant genetic disorder through the production of an altered protein that works against the action of the normal protein?

Dominant-negative

T or F Both members of identical and fraternal twin pairs have the same likelihood of expressing the same genetic disease.

False

The disease hemophilia is caused by a deficiency in any one of three blood clotting factors. Two of these factors are encoded by genes on the X-Chromosome and the other clotting factor gene is located on an autosome. Since mutations in more than one gene can cause hemophilia, this represents

Locus heterogeneity

T or F

Many human and animal genetic disorders share similar characteristics.

Hemophilia and colorblindness are both X-linked, recessive traits. A hemophiliac woman marries a colorblind man. Assume that both are otherwise normal. If meiosis occurs normally for both parents, what phenotypes are possible among their offspring?

Phenotypically normal daughters and hemophiliac sons

which of these is a common example of widespread genetic screening of newborns to identify certain disorders?

Test for excess phenylalanine indicating phenylketonuria (PKU)

Which type of catalytic activity occurs in prion-caused diseases?

The abnormal form of the prion protein catalyzes a reaction that converts normal proteins to misfolded ones

T or F Genetic disorders are more common in families with one affected member as compared to the general population

True

T or F Most genetic diseases have a specific age of onset.

True

T or F Prions are composed of protein.

True

T or F Scarpie and mad cow disease are examples of prion diseases.

True

T or F The prion protein is normally found in nerve cells

True

T or F. An individual who exhibits a disease is more likely to have genetic relatives with the disorder than are people in the general population.

True

T or F. Identical twins share the disease more often than nonidentical twins.

True

Only females exhibit the trait when it is lethal to males, and affected mothers have a 50% chance of passing the trait to daughters.

X-linked dominant

What is the inheritance pattern for a trait that is more likely to occur in females when it is lethal to males?

X-linked dominant

Males are much more likely to exhibit the trait, and mothers of affected males often have brothers or fathers who are affected.

X-linked recessive

What is the inheritance pattern for a trait that more commonly affects males than females and can often be observed in brothers or fathers of a woman who has affected sons?

X-linked recessive

64. A couple has four children, two sons and two daughters. One son has hemophilia and the other does not. One daughter has hemophilia and the other is a carrier. What were the genotypes of the mother and the father?

XHXh-A and Xh-AY

Genetic heterogeneity could be described as

a situation where people with the same phenotype have different genotypes.

The two main techniques used for determining genetic abnormalities during pregnancy are _______and _______ _______sampling.

amniocentesis ; chorion villi

______________ sampling can occur in the 10th-12th week of pregnancy.

chorionic villus

Duchenne muscular dystrophy, which is inherited in an X-linked recessive manner, is caused by a mutation in the gene for

dystrophin

in vitro fertilization is a procedure in which

eggs and sperm are combined outside the mothers body

It takes several weeks before the results from amniocentesis are known because there are very few _____ cells in the fluid.

fetal

Marfan syndrome, which is inherited in an autosomal dominant manner, is caused by a mutation in the gene for

fibrllin-1

a karyotype can be used to

identify changes in chromosome number and structure associated with a disease condition

genetic testing is used to determine whether a(n) ______ has a disease causing gene, while genetic screening is used to determine how frequently the gene is found in a(n) _____

individual ; population

Chorion cells can be ______ directly so the procedure is quicker.

karyotyped

Amniocentesis carries _____of a risk of miscarriage than chorionic villus sampling.

less

Chorionic villus sampling requires removal of a small part of the ______ called the chorion.

placenta

Embryos produced by in vitro fertilization can undergo genetic testing by

preimplantation genetic diagnosis

Chromosomal abnormalities related to genetic diseases can be detected by

producing a karyotype

when a defect in a single gene causes a human disease, the mutant gene often follows

simple mendelian inheritance patterns

human disorders that are inherited in an X-linked dominant manner

-Rett syndrome -Vitamin-D resistant rickets -Incontinentia pigmenti

human disorders inherited in an autosomal recessive fashion

-sickle cell disease -phenylketonuria -cystic fibrosis

There are three common explanations for autosomal dominant disorders: 1) ; 2) -of- mutations; and dominant 3) ____ mutations.

1) haploinsufficiency 2) gain-of-function 3) dominant negative mutations

T or F Genetic diseases are spread by shared environmental conditions.

False

T or F Genetic diseases occur at the same rate in all human populations.

False

T or F Prions always exist in the abnormal protein conformation

False

T or F The only way to develop a prion disease is to eat tainted meat.

False

T or F. A genetic disease is spread to individuals sharing similar environmental situations

False

T or F. Dizygotic twins share a genetic disease more frequently than monozygotic twins

False

In one study, autism shows 0% concordance for monozygotic twins and 0% concordance for dizygotic twins. This demonstrates that autism is

a genetic disease

An affected offspring usually has one or two affected parents, and the trait occurs equally in both sexes

autosomal dominant

What is the inheritance pattern when the trait occurs with the same frequency in both sexes and two affected heterozygotes have, on average, 25% unaffected children?

autosomal dominant

Frequently an affected offspring has two unaffected parents, and the trait occurs equally in both sexes.

autosomal recessive

What is the inheritance pattern when the trait occurs with the same frequency in both sexes and two unaffected heterozygotes have, on average, 25% affected children?

autosomal recessive

A dominant genetic disorder can be caused by a ____ mutation, where the product of an altered gene gains a new or abnormal function.

gain-of-function

Nontraumatic epilepsy shows a concordance of 70% for monozygotic twins and 6% for dizygotic twins. This demonstrates that nontraumatic epilepsy is a

genetic disease

Amniocentesis is a procedure for

obtaining fetal cells in a sample from the fluid surrounding the fetus

A prion is a disease-causing agent made

only of protein

what tool do scientists use to follow a human pattern of inheritance from generation to generation?

pedigree analysis

Prions cause diseases called transmissible

spongiform encephalopathy

An example of a phenocopy is the drug ________ which could produce a phenotype similar to the genetic disease _________.

thalidomide ; phocomelia

personalized medicine

the use of information about a patient's genotype and other clinical data in order to select a medication, therapy, or preventative measure that is specifically suited to that patient

Which of these factors provides evidence that the disorder may have a genetic cause?

An increased frequency of the disorder in blood relatives of an affected individual than in the general population.

Type of testing : Antibodies are used to detect the presence or absence of a protein. (Click to select)

Immunological

Type of testing: DNA probe that hybridizes to a particular gene can be used to determine if a gene is present, absent or altered

In situ hybridization

Type of testing: Chromosomes from a sample of cells are stained and analyzed microscopically

Karyotyping

chorionic villus sampling is a procedure for

obtaining a sample of the fetal part of the placenta