Lab Practical #2

In humans, the number of fingers is controlled by one gene. For this finger number gene, six fingers (F) is (surprisingly!) the dominant trait and five fingers (f) is the recessive trait. It turns out that the dominant six finger allele is very rare in humans (Links to an external site.) so there are very few people with six fingers. For this question both parents are heterozygous for the finger number gene and they are curious what possible traits their children might have. Since they know you are taking biology they ask for your advice:

...

In mice, black fur (B) is dominant over brown fur (b). Breeding a brown-furred mouse and a black-furred mouse produces all black-furred F1 generation offspring.

...

Remember that the number of fingers is controlled by one gene. For this finger number gene, six fingers (F) is the dominant trait and five fingers (f) is the recessive trait. For this question the father is heterozygous for six fingers and the mother has five fingers. Use this information to answer the questions below:

...

Recombinant proteins produced by E.coli are not glycosylated. This is because E. Coli cells do not possess ...

...Golgi apparatus.

Bacterial cells often cannot produce recombinant proteins that are identical to their wild type versions. The reason for this is that bacterial cells

...lack the machinery for making post-translational modifications.

The macromolecule ionization method, such as MALDI, allows us to obtain a peptide mass fingerprint (PMF) that can be used to ...

...predict the identity of an unknown protein.

The recessive allele b occurs with a frequency of 0.8 in a population of crabs that is in Hardy-Weinberg equilibrium. What is the frequency of homozygous dominant individuals?

0.04

After graduation, you and 19 of your closest friends (let's say 10 males and 10 females) charter a plane to go on a round-the-world tour. Unfortunately, you all crash land (safely) on a deserted island. No one finds you and you start a new population totally isolated from the rest of the world. Eight of your friends carry (i.e. are heterozygous for) the recessive cystic fibrosis allele (c) and none of your friends suffer from cystic fibrosis. a. What is the starting allele frequency of the cystic fibrosis allele (c)? b. What is the starting allele frequency of the dominant normal (non-disease) allele (C)? c. If the frequency of the cystic fibrosis allele does not change as the population grows, what will be the incidence of cystic fibrosis on your island? d. Cystic fibrosis is a recessive condition that affects about 1 in 2,500 babies in the United States. Based on this information what is the frequency of the recessive allele in the population? e. The frequency of cystic fibrosis on your island is significantly different than the frequency of cystic fibrosis for the US population . Given this, which mechanism of evolution (natural selection, genetic drift, or gene flow) created this difference?

0.2 0.8 0.04 0.02 Genetic Drift

Sickle-cell anemia is an interesting genetic disease. Normal homozygous individuals (SS) have normal blood cells that are easily infected with the malarial parasite. Thus, many of these individuals become very ill from the parasite and many die. Individuals homozygous for the sickle-cell trait (ss) have red blood cells that readily collapse when deoxygenated. Although malaria cannot grow in these red blood cells, individuals often die because of the genetic defect. However, individuals with the heterozygous condition (Ss) have some sickling of red blood cells, but generally not enough to cause mortality. In addition, malaria cannot survive well within these "partially defective" red blood cells. Thus, heterozygotes tend to survive better than either of the homozygous conditions. a. If 9% of an African population is born with a severe form of sickle-cell anemia (ss), what is the frequency of the recessive sickle-cell anemia allele (s)? b. What percentage of the population will be more resistant to malaria because they are heterozygous (Ss) for the sickle-cell gene? b. Interestingly, the frequency of the sickle cell allele is much higher in individuals from African descent where malaria is prevalent and much lower in individuals from European descent where malaria is rare. Which mechanism of evolution (natural selection, genetic drift, or gene flow) most likely created this difference?

0.3 0.42 Natural Selection

You have sampled a population in which you know that the percentage of the homozygous recessive genotype (aa) is 36%. Using the fact that 36% of the population is aa, calculate the following: a. What is the frequency of the "aa" genotype written as a decimal? b. What is the frequency of the "a" allele? c. What is the frequency of the "A" allele? d. What is the frequency of the "AA" genotype? e. What is the frequency of the "Aa" genotype? f. If "A" is completely dominant over "a" what is the frequency of the recessive phenotype? g. If "A" is completely dominant over "a" what is the frequency of the dominant phenotype?

0.36 0.6 0.4 0.16 0.48 0.36 0.64

Based on the mass spectrometry result, the masses of rhEPO in CHO and E. coli cells are 30 kDa and 18 kDa, respectively. We also know that the EPO proteins expressed in mammalian cells are glycosylated. Therefore, we can say that ..... of rhEPO expressed in CHO are polysaccharides.

0.4

In hummingbirds feather color is incompletely dominant. A rather large population of hummingbirds has 396 red-sided individuals (RR), 257 brown sided individuals (Rr) and 557 tan-sided individuals (rr). Calculate the following: a. What is the allele frequency of the R allele (p)? b. What is the allele frequency of the r allele (q)? c. Using the allele frequencies above (p and q), what is the predicted frequency of RR individuals in the next generation? d. Using the allele frequencies above (p and q), what is the predicted frequency of Rr individuals in the next generation? e. Using the allele frequencies above (p and q), what is the predicted frequency of rr individuals in the next generation? Migration season comes and 200 of the red-sided individuals leave the population before mating occurs. f. After migration season, what is the new allele frequency of the R allele (p)? g. After migration season, what is the new allele frequency of the r allele (q)? h. Using the post-migration allele frequencies above (p and q), what is the predicted frequency of RR individuals in the next generation? i. Using the post-migration allele frequencies above (p and q), what is the predicted frequency of Rr individuals in the next generation? j. Using the post-migration allele frequencies above (p and q), what is the predicted frequency of rr individuals in the next generation? k. Which mechanism of evolution (natural selection, genetic drift, or gene flow) caused the allele frequencies to change?

0.43 0.57 0.19 0.49 0.32 0.32 0.68 0.10 0.44 0.46 Gene flow

If DNA with the sequence below is mixed with a restriction enzyme that cuts at the recognition sequence GAATTC then how many times will the DNA be cut? Refer back to Figure 3 in the introduction and the video above. CAGTGATCTCGAATTCGCTAGTAACGTT

1

The frequency of the recessive allele plus the frequency of the dominant allele always equals

1

What fraction of the 16 boxes in your Punnett square from Question 16 have the genotypes that represent children with the free earlobes and light hair phenotype that you chose in the last question?

1/16

What is the probability that these parents will have a 5 fingered child

1/2

What is the probability that these parents will have a 6 fingered child?

1/2

What is the probability that these parents will have a 5 fingered child?

1/4

Two black-furred F1 generation mice from the problem above are bred with one another. Use a Punnett Square to work out the genotypic ratio and phenotypic ratio for this cross. After you have worked through the problem select the correct answers below. What is the genotype ratio of the F2 offspring from this cross? What is the phenotype ratio of the F2 offspring from this cross?

1/4 BB : 1/2 Bb : 1/4 bb 3/4 black-furred : 1/4 brown-furred

Based on the mass spectrometer result, what is the mass difference between rhEPO?

12 kDa

How many sets of primers are needed for DNA profiling?

13

If DNA with the sequence below is mixed with a restriction enzyme that cuts at the recognition sequence GAATTC then how many times will the DNA be cut? Refer back to Figure 3 in the introduction and the video above. TCATGAATTCCTGGAATTCAGCAAATGC

2

A linear DNA molecule is represented below. The DNA is represented by one line although in actuality, DNA has two strands. The linear DNA molecule below has two restriction enzyme recognition sites - A and B. How many DNA fragments would be produced if the DNA is cut by the restriction enzymes that cut at both the A and B recognition sites?

3

In the picture of the mRNA being translated inside of a ribosome below the first codon of the mRNA is base pairing with the complementary tRNA. What is the sequence of the anticodon in this tRNA?

3' - CGU - 5'

Primers are always designed to be complementary to the template DNA strand. The complementary sequence to the template sequence 5'-GTGGTCTGATCAACGGTAA-3' is ...

3'-CACCAGACTAGTTGCCATT-5'

What fraction of the 16 boxes in your Punnett square from Question 16 have the genotypes that represent children with the free earlobes and light hair phenotype that you chose in the last question?

3/16

What is the probability that these parents will have a 6 fingered child?

3/4

e. The frequency of cystic fibrosis on your island is significantly different than the frequency of cystic fibrosis for the US population . Given this, which mechanism of evolution (natural selection, genetic drift, or gene flow) created this difference?

31%

Based on the mass spectrometry results, how many glycosylation sites exist in rhEPO-CHO?

4

For Paternity Case #1, How many DNA fragments does child C1 have in common with alleged father AF1?

4

For Paternity Case #1, How many DNA fragments does child C1 have in common with mother M1?

4

In the picture of the mRNA being translated inside of a ribosome below, what is the sequence of the first codon?

5' - GCA - 3'

If a template strand of DNA has this sequence: 3' - ATGGCCTAG - 5' What will the sequence of the mRNA strand be that is produced from this template strand?

5' - UACCGGAUC - 3'

DNA polymerase binds to the template DNA, and synthesizes new DNA in a ... direction.

5' → 3'

Which is the correct mRNA sequence resulting from the EPO gene transcription process?

5'- AUU ACA AUG GGG GUG CAC GAA UGU CCU -3'

The tRNA in the diagram will be able to form a base-pair interaction with which mRNA?

5'-AGU-3'

The erythropoietin protein is 193 amino acid long, that means the number of nucleic acids in mRNA including the initiator and terminator codons is ...

582

Match the phase with the number Prophase Metaphase Anaphase Telophase

8 5 4 2

What fraction of the 16 boxes in your Punnett square from Question 16 have the genotypes that represent children with the free earlobes and dark hair phenotype that you chose in the last question?

9/16

Compare the sample results from each athlete with the control results. View the "Explore" area in the video to see the chart with the results to answer this question. There are two controls: Positive control: contains rhEPO only. Negative control: only includes urine. No rhEPO in this control. Which athlete is using rhEPO?

A

Positive (+) end of the gel chamber

A

In humans, there are three alleles for blood type: A, B, and O. The alleles for type A and type B blood are codominant. A person with one A and one B allele has blood type AB demonstrating how both traits are expressed together. The A and B alleles are dominant over the O allele. A person that is homozygous for the O allele will have O blood. A man with alleles for blood types A and O marries a woman with alleles for blood type B and O. Since the man has the genotype AO what is his phenotype? Since the woman has the genotype BO what is her phenotype? What will be the genotypes of the man's gametes? What will be the genotypes of the woman's gametes? What fraction of the Punnett square boxes have genotypes that represent children with type A blood? What fraction of the Punnett square boxes have genotypes that represent children with type B blood? What fraction of the Punnett square boxes have genotypes that represent children with type AB blood? What fraction of the Punnett square boxes have genotypes that represent children with type O blood?

A blood B blood A; O B; O 1/4 1/4 1/4 1/4

For the DNA sequence shown below what is the sequence of the complementary bottom strand of DNA? TCATGAATTCCTGGAATTCAGCAAATGC

AGTACTTAAGGACCTTAAGTCGTTTACG

Which of these is heterozygous?

Aa

The DNA polymerase extends the primers into a new DNA strand by ...

Adding nucleotides to the 3' end of the primers

Which of the following is not found in a DNA strand?

Amino Acid

During which of the following phases of meiosis do homologous chromosomes separate?

Anaphase I

The step in a PCR reaction when primers bind to the template DNA is called the ... step.

Annealing

The ____ is the name of the positive electrode in the gel chamber.

Anode

The complementary three-base sequence on a tRNA that pairs with the codon on an mRNA to assemble the correct sequence of amino acids in a polypeptide

Anticodon

It is possible to distinguish individuals by running these PCR products on a gel because the PCR products ...

Are different lengths

It is important to change the pipette tip to ...

Avoid cross contamination

Gel wells for loading DNA

B

X, Y, and Z refer to the parts of a mass spectrometer. X detects the number of different ions. Y is where ion production from the sample takes place. Z separates ions with different mass-to-charge ratios. Which diagram is the correct representation of X, Y and Z?

B

The main two secondary structures of proteins are alpha helix and beta sheet which are marked by ... and ... in the image.

B and A

What genotype is the black-furred parent?

BB

The area where the primers bind marks the ... of the PCR product that is be synthesized.

Beginning

The function of primers in a PCR reaction is to ...

Bind specific sites on the DNA

Have a look at this simplified depiction of a DNA strand. Which strand is the template strand?

Bottom

Smallest DNA Fragments

C

The circles in the image indicate the chemical group in which the next base is attached. Which image has the circle in the correct position?

C

Match the letters for the parts of a chromosome with the correct names for the labels below. The letters will only be used once and there are no extra letters. Centromere Chromosome Sister Chromatids

C A B

Glycosylation sites are marked with a diagram of glycan. Based on the mass spectrometry results, rhEPO is glycosylated in which expression system?

CHO

Which type of inheritance has 2 or more completely dominant alleles? Ex: Parent 1 has blood type A + Parent 2 has blood type B = Child with blood type AB.

Codominance

A three-base sequence on mRNA that codes for a particular amino acid that is "read" by tRNA

Codon

Each sequence of three nitrogen-containing bases of RNA that codifies one amino acid is called ...

Codon

The figure below depicts the different DNA puzzle pieces we used to make RNA and DNA nucleotides. Select all of the puzzle pieces that are used to make RNA below.

Cytosine Adenine Phosphate Uracil Guanine Ribose

Negative (-) end of the gel chamber

D

What is the template of the PCR reaction?

DNA

A process that takes place during the S-stage of interphase of the cell cycle where chromosomes are duplicated in a semiconservative manner and each new DNA molecule is composed of one parental ("old") strand and a second newly synthesized strand from free nucleotides

DNA Replication

Each person has a unique ________ that is the same in every cell of the body and can be used for identification.

DNA fingerprint

Which reagent acts as a template for the DNA polymerase, so it knows which new DNA to make?

DNA from a blood sample

Before the blood sample can be used for PCR ...

DNA has to be isolated from the cells

Nucleotides are substrates for the ...

DNA polymerase

1st child Hair Color Genotype Pigmentation Genotype

Dd PP or Pp- could be either

Mother Hair Color Genotype Pigmentation Genotype

Dd Pp

3rd child Hair Color Genotype Pigmentation Genotype

Dd or dd- could be either pp

Using 13 sets of primers for the DNA profile will ... probability of a 100 % match between two different individuals.

Decrease the

A pentose (5 carbon) sugar that is a component of DNA nucleotides and is derived from the sugar ribose by loss of an oxygen atom

Deoxribose

Given your answers to Introduction Questions 5 and 6 above, how could you distinguish the DNA molecules from the different organisms in Figure 2?

Differences in the sequence of the letter in the DNA strands

The number of repeats of each individual's tandem repeated regions can be different creating a specific DNA profile. When using one primer pair in different individuals, the PCR product will be of ...

Different lengths

Largest DNA Fragments

E

Since both parents are heterozygous for the finger number gene, what will be the genotypes of their gametes?

E and e

What will be the genotypes of the father's gametes?

E and e

Using your Punnett Square for the cross between two parents heterozygous for the earlobe trait and hair trait in Question 16 above answer the following question: Which genotypes in the Punnett square represent children with the free earlobes and dark hair phenotype? Select all that apply. Hint - both the free earlobes and dark hair traits are dominant

EEHH EeHh EEHh EeHH

Using your Punnett Square for the cross between two parents heterozygous for the earlobe trait and hair trait in Question 16 above answer the following question: Which genotypes in the Punnett square represent children with the free earlobes and light hair phenotype? Select all that apply. Hint - The free earlobes trait is dominant and the light hair trait is recessive

EEhh Eehh

Since both parents are heterozygous for the finger number gene, what is their genotype?

Ee

What is the genotype of the father?

Ee

Which of these options correctly shows the cross between these parents?

Ee x Ee

Which of these options correctly shows the cross between these parents?

Ee x ee

In humans, the allele for free earlobes (E) is dominant over the allele for attached earlobes (e). The allele for dark hair (H) is dominant over the allele for light hair (h). Two parents are heterozygous for both the earlobe and hair genes and they are curious what traits their children might have. They know you are taking biology so they ask you for advice: Since both parents are heterozygous for the earlobe and hair genes, what is their genotype? Since both parents are heterozygous for the earlobe and hair genes, what is their phenotype? Which of these options correctly shows the cross between these parents? Since both parents are heterozygous for the earlobe and hair traits, what will be the genotypes of their gametes?

EeHh Free Earlobes and Dark Hair EeHh x EeHh EH; Eh; eH; eh

The protein sample is mixed with a matrix prior to analysis. What is the function of a matrix in MALDI-TOF MS analysis?

Ensures ionization of protein molecules

Which of these nucleotide base pairings is incorrect?

G-T

For the DNA sequence shown below what is the sequence of the complementary bottom strand of DNA? CAGTGATCTCGAATTCGCTAGTAACGTT

GTCACTAGAGCTTAAGCGATCATTGCAA

Which of the following is used to separate DNA fragments by size?

Gel electrophoresis

Which mechanism of evolution results from migration between populations.

Gene flow

A small group of squirrels gets separated from the rest of the population due to a large flood. This small group of squirrels is washed away to a new island. Now confined to this new island, the small group of squirrels begins a new population. This is an example of which of the following?

Genetic Drift

Which of these is the mechanism of evolution that is caused by chance fluctuations in the gene pool.

Genetic Drift

A PCR cycle is repeated 30 times to ...

Get enough DNA

The court rules that alleged father AF1 is the father of child C1. Based on your answers to Questions 1 and 2 above, choose the best explanation for why the court ruled that AF1 is the father of C1.

Half of child C1's DNA fragments match alleged father AF1 and the other half of child C1's DNA fragments match Mother M1.

In mass spectrometry protein molecules are separated based on mass to charge ratio. View the data recorded in a histogram for analysis in the video to answer this question. Which of these histograms are NOT coherent with the mass spectrometry principle?

II, III, IV

In which type of inheritance is an intermediate phenotype observed. Ex: Curly hair + Straight hair = Wavy hair (Wavy is the INTERMEDIATE condition between the two parents).

Incomplete Dominance

Since the DNA samples are colorless, ____________ is added to facilitate loading the DNA samples into the wells of the gel.

Loading Dye

What is the correct amino acid sequence translated from the resulting mRNA?

MGVHECP

Mass spectrometry identifies molecules based on their ...

Mass and charge

What is true of populations that are in Hardy-Weinberg equilibrium?

Mating is random

MALDI is an abbreviation for ...

Matrix-assisted laser desorption/ionization.

Crossing over of chromosomes normally takes place during which of the following processes?

Meiosis I

Which of the following statements describes a major difference between meiosis II and mitosis in a diploid animal?

Meiosis II occurs in a haploid cell, while mitosis occurs in diploid cells.

During which of the following phases of meiosis does independent assortment apply?

Metaphase I

We can see bands on the E-gel because there is ... DNA.

Millions of copies of

Which mechanism of evolution is a change in DNA sequence.

Mutation

A population of birds live on an island where seeds are their primary food source. Birds with smaller beaks can eat small seeds more easily and birds with larger beaks can eat large seeds more easily. A fungus destroys the plants that make large seeds, leaving only the small seeds as food. The birds with the smaller beaks now have a beneficial trait and the small beak allele increases in frequency in the bird population. What mechanism is causing this evolution?

Natural Selction

Which mechanism of evolution results in adaptation to changing environmental conditions.

Natural Selection

Refer to Figure 2 above. Focus on the way the DNA bases A, T, G, and C are paired together (A pairs with ?, C pairs with ?, etc.) in all of the organisms (plant, human, bacteria). Are there any differences in base pairing?

No - A always pairs with the same letter and C always pairs with the same letter

Carefully analyze Paternity Case #2 above. Is AF2 the father of child C2a and C2b? Choose the best answer below.

No - None of the DNA fragments for C2a and C2b match AF2.

Refer to Figure 2 above. Focus on the sugar-phosphate (S-P) arrangement in the DNA "backbone" of all three organisms (plant, human, bacteria). Are there any differences?

No - all of the S-P backbones are the same.

Do your results confirm the initial hypothesis, that bacterial expression systems can produce biologically active and stable erythropoietin?

No, erythropoietin is best expressed in mammalian cells

What would happen if no polymerase was added to the PCR reaction? New DNA would ...

Not be generated

An organic polymer, specifically DNA or RNA, present in living cells that consists of many nucleotides linked in a long chain

Nucleic acids

Fill in the missing words:'... are the building blocks of new copies of ...'

Nucleotides, DNA

Protein synthesis is performed by an RNA -protein complex called the Ribosome. As you can see in the image area in the video a ribosome is composed of three site E, P, and A. The site where tRNA adds its amino acid to the polypeptide chain is ...

P

Multiple amino acids are linked together by ...

Peptide bonds

The figure below depicts the different DNA puzzle pieces used to make RNA and DNA nucleotides. Select all of the puzzle pieces that are used to make DNA below.

Phosphate Guanine Cytosine Adenine Deoxyribose Thymine

Due to the negative charge of the DNA, the DNA will move towards the ... of the E-gel in an electric field.

Positive pole

The linear sequence of amino acids within a protein is considered the ... structure of the protein.

Primary

Based on your analysis of the gel above, which suspect was at the crime scene and is a prime suspect for being the criminal that stole Tommy the iguana?

Professor Mason

What is the name of the table (or square) used to calculate the probabilities of offpspring genotypes?

Punnett

Which statement is NOT correct?

RNA is less reactive

What is the probability of each of the colors (red, pink, and white) appearing in the offspring? A cross is made between a red snapdragon and a pink snapdragon. Use the information above about the snapdragon flower color gene to answer the questions about this cross below: What is the genotype of the red snapdragon? What is the genotype of the pink snapdragon? Which of these options correctly shows the cross between these two snapdragons? What will be the genotypes of the gametes for the red snapdragon? What will be the genotypes of the gametes for the pink snapdragon? What is the probability that these pink snapdragons will have a red child? What is the probability that these pink snapdragons will have a pink child? What is the probability that these pink snapdragons will have a white child?

RR Rr RR x Rr R and R R and r 1/2 1/2 0/4- none of the children

EPO can increase production of energy (ATP) by increasing ... production.

Red blood cell

It is the ability to ... that makes the Taq-polymerase special compared to most other polymerases.

Resist high temperatures

______________ cut DNA at specific recognition sequences.

Restriction enzymes

A pentose (5 carbon) sugar that is a component of RNA nucleotides

Ribose

Eukaryotic cells synthesize proteins in ..., which is shown as number ... in the image in the video.

Ribosomes, 2

Two pink snapdragons are crossed. Use the information above to answer the questions about this cross below: Since both snapdragons have the pink phenotype, what is their genotype? Which of these options correctly shows the cross between these two snapdragons? What will be the genotypes of the gametes for these pink snapdragons? What is the probability that these pink snapdragons will have a red child? What is the probability that these pink snapdragons will have a pink child? What is the probability that these pink snapdragons will have a white child?

Rr Rr x Rr R and r 1/4 1/2 1/4

Which level of protein structure is formed by the weak bonds between oxygen and hydrogen atoms within the polypeptide backbone?

Secondary structure

At the Denaturation step in the PCR process, the DNA is ...

Separated into two strands

Which type of inheritance is affected by gender?

Sex-linked

Since both parents are heterozygous for the finger number gene, what is their phenotype?

Six fingers

Label new colored coded microfuge tubes for your restriction enzyme reactions.

Step 1

Place the gel into the gel chamber so that the wells (small holes) are near the black negative electrode (black)and pour electrophoresis running buffer into the chamber until the gel is covered with buffer.

Step 1

Add the DNA (lambda DNA in this video), restriction buffer, and restriction enzyme to the new microfuge tubes you labeled. Make sure to change tips for each solution to prevent contamination.

Step 2

Place your samples in the order that they will be added to the gel and use a micropipette to load the DNA samples into the gel wells.

Step 2

Flick the tubes to mix the reactions in the tubes. Place the tubes in a microcentrifuge and spin the sample for a few seconds to collect the at the bottom of each tube.

Step 3

Place the lid on the gel chamber, connect the gel chamber to the power supply, switch the power supply on, set the power supply at the right power level, and press start to begin the electrophoresis. At this point you should be able to see bubbles coming from the wires at each end of the gel box.

Step 3

Allow the electrophoresis to proceed and notice that the loading dyes for the sample move toward the positive electrode (red).

Step 4

Incubate the reactions for 30 minutes in a water bath at 37C.

Step 4

A DNA polymerase ...

Synthesizes DNA

An EPO gene is 582 bp long. This is the downstream section of the coding sequence for the erythropoietin mRNA: 5' - ACA GGG GAC AGA UGA - 3' Downstream means near the 3' end, so notice that the first codon is not methionine. What is the correct amino acid sequence?

TGDR

Cheetahs have come close to extinction due to hunting, drought, and disease. This has caused a decrease in the genetic variation in their populations. Which of the options below is most likely for cheetahs in the future?

The cheetah populations are less likely to be able to adapt to environmental changes.

After the linear DNA molecule below is cut at both the A and B recognition sites which of the resulting DNA fragments will be the shortest?

The fragment left of the A recognition site

After the linear DNA molecule below is cut at both the A and B recognition sites which of the resulting DNA fragments will be the longest?

The fragment to the right of the B recognition site

During the Denaturation step DNA strand separation is caused by the ...

The high temperature (95°C)

What can a DNA ladder help determine?

The length of a fragment

The biosafety cabinet is important for physical containment. In this lab we will use a biosafety cabinet class II. A level II biosafety cabinet protects ...

The personnel, the experiment, and the environment

The PCR products get a certain length due to ...

The placement of the primers

DNA and mRNA synthesis proceed in a 5' to 3' direction. What do 5' and 3' refer to?

The position of a carbon atom in the sugar backbone

What is the function of primers in a PCR reaction?

They bind specific sites on the template DNA to initiate and direct DNA synthesis

The purpose of PCR is ...

To copy and then make many copies of a specific region of DNA

DNA Replication A process of RNA synthesis that takes place within the nucleus when the DNA double helix unwinds and unzips, and a single strand of RNA is assembled using the nucleotide sequence of one of the DNA strands as a pattern (template)

Transcription

In the DNA puzzle picture below what process is occuring?

Transcription

DNA is the molecule of heredity that contains instructions to build proteins. In 1958, Francis Crick described the central dogma of molecular biology explaining the process of gene expression. Pick the correct term to fill in the blank spaces of the image.

Transcription; translation

The conversion of the linear message encoded in mRNA to a linear strand of amino acids to form a polypeptide by the interaction of mRNA, ribosomes, and transfer RNA (tRNA)

Translation

Contamination of reagents often leads to ...

Unreliable results

In humans, the condition for normal vision (XC) dominates color blindness (Xc) and both alleles are linked to the X chromosome. A normal man marries a colorblind woman and they are planning to have children. They know you are taking biology so they ask you for advice: Since the husband has normal vision what is his genotype? Since the wife is colorblind what is her genotype? Which of these options correctly shows the cross between these parents? What will be the genotypes of the husband's gametes? What will be the genotypes of the wife's gametes? If this couple has a daughter, what is the chance that she will have normal vision - what fraction of the boxes in your Punnett square that represent daughters have normal vision? If this couple has a son, what is the chance that he will have normal vision - what fraction of the boxes in your Punnett square that represent sons have normal vision?

XCY XcXc XcXc x XCY XC; Y Xc; Xc 2/2- both boxes -/2- none of the boxes

Both the DNA samples and the restriction enzyme mix that was added to the tubes in the video of the restriction enzyme process above was clear and colorless. In the absence of any visible evidence of change is it still possible that the DNA samples were fragmented?

Yes - DNA and enzymes are too small to be seen so it is possible that the reaction happened in the tubes

Are mammalian expression systems better than bacterial systems for the production of biologically active and stable erythropoietin?

Yes, erythropoietin is best expressed in mammalian cells

Which of theses is homozygous for the recessive allele?

aa

Which of the following statements describes a characteristic feature of metaphase?

alignment of chromosomes on the equator of the cell

What is the genotype of the gametes produced by the black-furred parent?

all are B

What genotype is the black-furred F1 generation offspring?

all are Bb

What is the genotype of the gametes produced by the brown-furred parent?

all are b

In which phase of mitosis do the sister chromatids become daughter chromosomes?

anaphase

What genotype is the brown-furred parent?

bb

The process of cytoplasmic division is known as

cytokinesis

2nd child Hair Color Genotype Pigmentation Genotype

dd PP or Pp- could be either

Father Hair Color Genotype Pigmentation Genotype

dd Pp

What will be the genotypes of the mother's gametes?

e and e

What is the genotype of the mother?

ee

Using your Punnett Square for the cross between two parents heterozygous for the earlobe trait and hair trait in Question 16 above answer the following question: Which genotypes in the Punnett square represent children with the attached earlobes and dark hair phenotype? Select all that apply. Hint - The attached earlobes trait is recessive and the dark hair trait is dominant

eeHh eeHH

Using your Punnett Square for the cross between two parents heterozygous for the earlobe trait and hair trait in Question 16 above answer the following question: Which genotypes in the Punnett square represent children with the attached earlobes and light hair phenotype? Select all that apply. Hint - The attached earlobes trait and the light hair trait are both recessive

eehh

Meiosis produces haploid:

gametes

Sperm cells are _____________.

haploid

2pq is the frequency of the

heterozygous individuals

Mendel's Law of ________ states that alleles for 2 different genes separate during meiosis and segregate independently.

independent assortment

What phase is highlighted in the image?

interphase

A single strand of RNA containing the code for a specific polypeptide that is created during transcription from the nucleotide sequence of the template DNA strand

mRNA

Sperm cells are formed using which of the following processes?

meiosis

What phase is highlighted with the arrows in the image?

metaphase II

The DNA is ... charged.

negatively

The observed trait an individual has is called the:

phenotype

The following diagram represents some of the puzzle pieces used in this section. Assembled in this form, do they represent a(n) amino acid, monosaccharide, portion of messenger RNA, or a deoxyribonucleotide?

portion of messenger RNA

Pigmented eyes (P) are dominant to non-pigmented (p), and dimpled chins (D) are dominant to non-dimpled chins (d). Suppose a dimple-chinned, blue-eyed (non-pigmented) man whose father lacked a dimpled-chin marries a woman who is homozygous recessive for both traits. What is the genotype of the woman? What is the genotype of the man? What are the possible genotypes of the man's gametes? What is the expected genotypic ratio of children produced in this marriage? What is the expected phenotypic ratio of the children?

ppdd ppDd 1/2 pD: 1/2 pd 1/2 ppDd : 1/2 ppdd 1/2 non-pigmented eyes and Dimpled chin : 1/2 non-pigmented eyes and non-dimpled chin

In which phase of mitosis does the chromatin condense?

prophase

What phase is highlighted in the image?

prophase

The correct sequence of stages in mitosis is

prophase, metaphase, anaphase, telophase

In the Hardy Weinberg equation the frequency of the recessive allele is represented as

q

In the Hardy Weinberg equation the frequency of the homozygous recessive individuals is represented as

q2

Sperm are produced in the __________.

seminiferous tubules

The mitotic spindle plays a critical role in which of the following processes?

separation of sister chromatids

What structure is found at the arrow labeled C

spermatid

During the S period of interphase

synthesis (or replication) of the DNA takes place

A type of RNA molecule that is formed into a four-cornered loop that is attached to specific free amino acids and then positions itself on ribosomes where the amino acids become linked together to form polypeptides

tRNA

Three types of RNA cooperate to perform translation. A : Read codons and deliver the amino acids.B : Carry the genetic information from DNA.C : Catalyze the assembly of polypeptide chains. Which type of RNA matches the A, B, and C descriptions, respectively?

tRNA, mRNA, rRNA

What phase is highlighted with the arrows in the image?

telophase II