Molecular biology sl

Primary amino acid structure

primary structure determines the way the chain will fold. Different amino acid sequences will fold into different configurations due to the chemical properties of the variable side chains (R group)

Methods of production of lactose-free milk and its advantages (immobilised enzymes)

"Lactose is a disaccharide of glucose and galactose which can be broken down by lactase" Lactose-free milk can be produced by treating the milk with the enzyme lactase. The lactase is cleaned from yeast or bacteria and then bound to an inert substance (such as alginate beads). Milk is then repeatedly passed over this immobilised enzyme, becoming lactose-free. Advantages: - As a source of dairy for lactose-intolerant individuals - As a means of increasing sweetness in the absence of artificial sweeteners (monosaccharides are sweeter tasting) - As a way of reducing the crystallisation of ice-creams (monosaccharides are more soluble, less likely to crystalise) - As a means of reducing production time for cheeses and yogurts (bacteria ferment monosaccharides more readily)

What is tRNA?

(mRNA carries genetic information from the nucleus to ribosomes for the synthesis of proteins) while tRNA carries specific amino acids to the ribosomes to assist the protein biosynthesis. rRNA provides the structural framework for the formation of ribosomes

Water Insoluble Substances

- Lipids (fats and cholesterol) are non-polar and hydrophobic and hence will not dissolve in water. They form complexes with proteins (lipoproteins) in order to move through the bloodstream. Hydrophilic portions of proteins, cholesterol and phospholipids will face outwards and shield internal hydrophobic components

Rate of enzyme activity and temperature

- Low temperatures result in insufficient thermal energy for the activation of an enzyme-catalysed reaction to proceed - Increasing the temperature will increase the speed and motion of both enzyme and substrate, resulting in higher enzyme activity. Meaning higher kinetic energy result in more frequent collisions between the enzymes and substrates. - Optimal temp vary - Higher temperatures will cause enzyme stability to decrease, as the thermal energy disrupts the enzyme's hydrogen bonds. This causes the enzyme (particularly the active site) to lose its shape, resulting in the loss of activity (denaturation)

Examples of Carbohydrates

- Monosaccharides (one sugar unit) are typically sweet-tasting and function as an immediate energy source for cells: E.g. glucose, galactose and fructose. - Disaccharides (two sugar units) are small enough to be soluble in water and commonly function as a transport form: E.g. lactose, maltose and sucrose. - Polysaccharides (many sugar units) may be used for energy storage or cell structure, and also play a role in cell recognition: E.g. cellulose, glycogen and starch

The replication of DNA is a semi-conservative process and depends on complementary base pairing

- One strand will be from the original template molecule - One strand will be newly synthesised Adenine (A) pairs with thymine (T) Cytosine (C) pairs with guanine (G) Consequently, when DNA is replicated by the combined action of helicase and DNA polymerase: - Each new strand formed will be identical to the original strand separated from the template. - The two semi-conservative molecules formed will have an identical base sequence to the original molecule

The process of translation

- Ribosomes bind to mRNA in the cytoplasm and move along the molecule in a 5' - 3' direction until it reaches a start codon (AUG). - Anticodons on tRNA molecules align opposite appropriate codons according to complementary base pairing (e.g. AUG = UAC) - Each tRNA molecule carries a specific amino acid (according to the genetic code) - Ribosomes catalyse the formation of peptide bonds between adjacent amino acids (via condensation reactions) - The ribosome moves along the mRNA molecule synthesising a polypeptide chain until it reaches a stop codon. At this point translation ceases and the polypeptide chain is released

Water Soluble Substances

- Sodium chloride (NaCl) is an ionic compound and its components (Na+ and Cl-) may be freely transported within the blood - Oxygen is soluble in water but in low amounts - most oxygen is transported by haemoglobin within red blood cells - Glucose contains many hydroxyl groups (-OH) which may associate with water and thus can freely travel within the blood - Amino acids will be transported in the blood in an ionized state (either the amine and/or carboxyl groups may be charged)

Lipid Health Claims and evidence supporting and against health claims

2 main health claims about lipids in diet: - Diets rich in saturated fats and trans fats increase the risk of CHD. - Diets rich in monounsaturated and polyunsaturated (cis) fats decrease the risk of CHD. health claims evidence: - Epidemiological studies comparing different population groups - Intervention studies that monitor group following dietary modifications - Experimental designs utilising animal models or data based on autopsies SUPPORT: A positive correlation has been found between the intake of saturated fats and the incidence of CHD. - Counter: Certain populations do not fit this trend (e.g. the Maasai tribe, Africa eat fat-rich diet but low rates of CHD) Intervention studies have shown that lowering dietary intakes of saturated fats reduces factors associated with the development of CHD (e.g. blood cholesterol levels, blood pressure, etc.) - Counter: Validity of intervention studies is dependent on size, time and composition of group In patients who died from CHD, fatty deposits in diseased arteries were found to contain high concentrations of trans fats - Counter: Genetic factors may play a role (e.g. blood cholesterol levels only show a weak association to dietary levels) AGAINST Proportion of saturated and trans fats in Western diets has decreased over the last 50 years, but incidence of CHD has risen - Counter: Increased carbohydrate intake may cause detrimental health effects associated with CHD (e.g. diabetes, obesity) - Counter: Incidence of CHD dependent on a countless of factors besides dietary intake (e.g. exercise, access to health care, etc.)

The nucleic acids DNA and RNA are polymers of nucleotides:

2 types of nucleic acids present in cells: - DNA (deoxyribonucleic acid) is a more stable double stranded form that stores the genetic blueprint for cells. - RNA (ribonucleic acid) is a more versatile single stranded form that transfers the genetic information for decoding Both DNA and RNA are polymers of nucleotides, however key differences exist in the composition of DNA and RNA nucleotides

Meselson and Stahl's three hypothesis for results to obtain support for the theory of semi-conservative replication of DNA

3 hypothesis for experiment: - Conservative Model - An entirely new molecule is synthesised from a DNA template (which remains unaltered) - Semi-Conservative Model - Each new molecule consists of one newly synthesised strand and one template strand - Dispersive Model - New molecules are made of segments of new and old DNA

Nucleotide

5-carbon pentose sugar (pentagon) Phosphate group (circle) Nitrogenous base (rectangle)

Proteome

= the totality of proteins expressed within a cell, tissue or organism at a certain time. The proteome of any given individual will be unique, as protein expression patterns are determined by an individual's genes. The proteome is always significantly larger than the number of genes in an individual due to: - Gene sequences may be alternatively spliced following transcription to generate multiple protein variants from a single gene - Proteins may be modified (e.g. glycosylated, phosphorylated, etc.) following translation to promote further variations

The amino acid sequence of polypeptides is coded for by genes

A gene is a sequence of DNA which encodes a polypeptide sequence. A gene sequence is converted into a polypeptide sequence via two processes: - Transcription - making an mRNA transcript based on a DNA template (occurs within the nucleus) - Translation - using the instructions of the mRNA transcript to link amino acids together (occurs at the ribosome) Typically, one gene will code for one polypeptide - exceptions : - Genes may be alternatively spliced to generate multiple polypeptide variants - Genes encoding tRNA sequences are transcribed but never translated - Genes may be mutated (their base sequence is changed) and consequently produce an alternative polypeptide sequence

ATP from cell respiration is immediately available as a source of energy in the cell

ATP (adenosine triphosphate) is a high energy molecule that functions as an immediate source of power for cell processes. One molecule of ATP contains three covalently linked phosphate groups - which store potential energy in their bonds. When ATP is hydrolysed (to form ADP + Pi) the energy stored in the phosphate bond is released to be used by the cell. Cell respiration uses energy stored in organic molecules to regenerate ATP from ADP + Pi (via oxidation)

ATP, Energy Storage Analogy, lipids vs carbohydrates

ATP is the energy currency of the cell - in this respect it is like cash. Cash is earned when you work (cell respiration) and can be spent in a number of ways (metabolism). Storing energy as carbohydrates (i.e. glycogen) is similar to keeping the cash in a wallet. It is easier to carry around (monosaccharides and disaccharides are water soluble). It is readily accessible (carbohydrates are easier to digest). You cannot carry as much (carbohydrates store less energy per gram). Storing energy as lipids (i.e. triglycerides) is similar to keeping the cash in a safe. It is not viable to carry around (triglycerides are insoluble in water) It is harder to access (triglycerides cannot be easily digested). You can keep more cash in it (triglycerides store more energy per gram)

denaturation of enzymes

All enzymes possess a cut or hole to which the substrate can bind with high specificity - this is the active site. The shape and chemical properties of the active site are highly dependent on the tertiary structure of the enzyme. Like all proteins, enzyme structure can be modified by external factors. Any change to the structure of the active site (denaturation) will negatively affect the enzyme's capacity to bind the substrate

secondary amino acid structure: Alpha helices and Beta-pleated sheets

Amino acid sequences will commonly fold into two stable configurations = secondary structures. - Alpha helices occur when the amino acid sequence folds into a coil / spiral arrangement (looks like DNA) - Beta-pleated sheets occur when the amino acid sequence adopts a directionally-oriented staggered strand conformation Both α-helices and β-pleated sheets result from hydrogen bonds forming between non-adjacent amine and carboxyl groups. Where no secondary structure exists, the polypeptide chain will form a random coil.

Amino acids can be linked together in any sequence giving a huge range of possible polypeptide

Amino acids are joined together on the ribosome to form long chains called polypeptides, which make up proteins. Each type of amino acid differs in the composition of the variable side chain (R group) These side chains will have distinct chemical properties (e.g. charged, non-polar, etc.) and hence cause the protein to fold and function differently according to its specific position within the polypeptide chain. As most natural polypeptide chains contain between 50 - 2000 amino acid residues, organisms are capable of producing a huge range of possible polypeptides.

Amino acids are linked together by condensation to form polypeptides

Amino acids can be covalently joined together in a condensation reaction to form a dipeptide and water(bi-product) The covalent bond is a peptide bond and long chains of covalently bonded amino acids are called polypeptides. Polypeptide chains can be broken down via hydrolysis (catabolism) reactions, which requires water to reverse the process

Enzymes

An enzyme is a globular protein acting as biological catalyst. Enzymes are not changed or consumed by the reactions they catalyse and thus can be recycled. Enzymes are typically named after the molecules they react with (substrate) & end '-ase'

organic compounds

An organic compound is a compound that contains carbon and is found in living things. Exceptions include carbides (e.g. CaC2), carbonates (CO32-), oxides of carbon (CO, CO2) and cyanides (CN-)

Anabolism is the synthesis of complex molecules from simpler molecules including the formation of macromolecules from monomers by condensation reactions

Anabolic reactions describe the set of metabolic reactions that build up complex molecules from simpler ones via condensation reactions. Condensation reactions occur when monomers are covalently joined and water is produced as a by-product Purpose: build from small to larger molecules energy: uses energy in constructions of new bonds(endergonic) mechanism : mainly reduction reaction example: gluconeogenesis

Anaerobic cell respiration

Anaerobic respiration proceeds in the absence of oxygen and does not result in the production of any further ATP molecules. - In animals, the pyruvate is converted into lactic acid (or lactate) - In plants and yeasts, the pyruvate is converted into ethanol and carbon dioxide. The purpose of anaerobic respiration is to restore stocks of NAD+ - as this molecule is needed for glycolysis. By restoring stocks of NAD+ via anaerobic pathways, the organism can continue to produce ATP via glycolysis. The conversion of pyruvate into lactic acid (animals) or ethanol and CO2 (plants / yeasts) is reversible. Meaning, pyruvate levels can be restored once oxygen is present and a greater yield of ATP may be produced aerobically.

Insulin Production via Recombinant Gene Transfer

As the same codons code for the same amino acids in all living things, genetic information is transferrable between species.The ability to transfer genes between species has been utilised to produce human insulin in bacteria (for mass production) - The gene responsible for insulin production is extracted from a human cell - It is spliced into a plasmid vector (for autonomous replication and expression) before being inserted into a bacterial cell - The transgenic bacteria (typically E. coli) are then selected and cultured in a fermentation tank (to increase bacterial numbers) - The bacteria now produce human insulin, which is harvested, purified and packaged for human use (i.e. by diabetics)

Life is based on carbon compounds including carbohydrates

Carbohydrates - Most abundant organic compound found in nature, composed primarily of C,H and O atoms in a common ratio - (CH2O)n - Principally function as a source of energy (and as a short-term energy storage option) - Also important as a recognition molecule (e.g. glycoproteins) and as a structural component (part of DNA / RNA)

Monosaccharide monomers are linked together by condensation reactions to form disaccharides and polysaccharide polymers

Carbohydrates are made of C, H and O ('carbo' - contains carbon ; 'hydrate' - contains H and O) Carbohydrates are composed of recurring monomers called monosaccharides (which typically form ring structures) These monosaccharides may be linked together via condensation reactions (water is formed as a by-product) - Two monosaccharide monomers may be joined via a glycosidic linkage to form a disaccharide - Many monosaccharide monomers may be joined via glycosidic linkages to form polysaccharides

carbon and covalent bonds

Carbon forms the basis of organic life due to its ability to form large and complex molecules via covalent bonding. Carbon atoms can form four covalent bonds, with bonds between carbon atoms being particularly stable (catenation). These properties allows carbon to form a wide variety of organic compounds that are chemically stable.

Catabolism is the breakdown of complex molecules into simpler molecules including the hydrolysis of macromolecules into monomers

Catabolic reactions describe the set of metabolic reactions that break complex molecules down into simpler molecules. The breakdown of organic molecules via catabolism typically occurs via hydrolysis reactions. Hydrolysis reactions require the consumption of water molecules to break the bonds within the polymer. Purpose: breakdown from large complex to smaller molecules. energy: releases energy in breaking of bonds (exergonic) mechanism : mainly oxidation reaction example: glycolysis

ATP production (cell respiration) (catabolic)

Cell respiration is the controlled release of energy from organic compounds to produce ATP. The main organic compound used for process= carbohydrates (glucose) (lipids and proteins can also be digested) There are two main types of cell respiration: - Anaerobic respiration - Aerobic respiration

Structure and function of cellulose in plants (polymers)

Cellulose is a structural polysaccharide that is found in the cell wall of plant. It is a linear molecule composed of β-glucose subunits (bound in a 1-4 arrangement) therefore it is not able to be digested for most animals (lack the enzyme required to break it down) - Ruminants (e.g. cows) may digest cellulose due to the presence of helpful bacteria in a specialised stomach. - Caecotrophs (e.g. rabbits) will re-ingest specialised faeces that contain digested cellulose (broken down in the caecum)

Rate of enzyme activity and pH

Changing the pH will alter the charge of the enzyme, which in turn will alter protein solubility and overall shape. Changing the shape or charge of the active site will diminish its ability to bind the substrate, abrogating enzyme function Optimal pH differ

sugar vs lipids

Comparison: Mnemonic: SODAS Storage: lipids are more suitable for long-term energy storage Osmolality: lipids have less of an effect on the osmotic pressure of a cell Digestion: carbohydrates are easier to digest and utilise ATP Yield: lipids store more energy per gram Solubility: carbohydrates are easier to transport in the bloodstream

DNA vs RNA

DNA and RNA are both polymers of nucleotides, however differ in a few key structural aspects: - Number of strands present - Composition of nitrogenous bases - Type of pentose sugar

DNA replication polymerase

DNA polymerase synthesises new strands from the two parental template strands. Free deoxynucleoside triphosphates (nucleotides with 3 phosphate groups) align opposite their complementary base partner. DNA polymerase splits the two excess phosphates and uses the energy released to link the nucleotide to the new strand. Meaning: DNA polymerase links nucleotides together to form a new strand, using the pre-existing strand as a template

DNA replication

DNA replication is a semi-conservative process whereby pre-existing strands act as templates for newly synthesised strands

denaturation of proteins

Denaturation is a structural change in a protein resulting in the loss (usually permanent) of biological properties. Because the way a protein folds determines its function, any change or removal of the tertiary structure will alter its activity. Caused by two key conditions: Temperature - High thermal energy may disrupt the hydrogen bonds that hold the protein together. The breaking causes the protein to unfold and lose its capacity to function as intended. Temp. proteins denature vary, but most human proteins optimal (~37ºC) pH - Amino acids are zwitterions, neutral molecules possessing both negatively (COO-) and positively (NH3+) charged regions. Change in pH alters the charge of the protein, which in turn will alter protein solubility and overall shape. All proteins have an optimal pH which is dependent on the environment in which it functions (e.g. stomach proteins require an acidic environment to operate and blood proteins function best at a neutral pH)

Enzyme Catalysis

Enzyme reactions typically occur in aqueous solutions (e.g. cytoplasm, interstitial fluid, etc.) Consequently, the substrate and enzyme are usually moving randomly within the solution (Brownian motion) Sometimes an enzyme may be fixed in position (e.g. membrane-bound) - serves to localise reactions to particular sites. Enzyme catalysis requires that the substrate be brought physical close with the active site. When a substrate binds to the enzyme's active site, an enzyme-substrate complex is formed. The enzyme catalyses the conversion of the substrate into product, creating an enzyme-product complex. The enzyme and product then dissociate so enzyme can continue catalysing

fatty acids (general)

Fatty acids are long hydrocarbon chains that are found in certain types of lipids (triglycerides & phospholipids) Fatty acids may differ in the length of the hydrocarbon chain (typically 4 - 24 carbons) and in the number of double bond. It has a carboxyl group like amino acids

saturated fatty acids

Fatty acids that possess no double bonds are saturated (have maximum number of H atoms) Saturated fatty acids are linear in structure, originate from animal sources (i.e. fats) and are typically solid at room temperatures

unsaturated fatty acids - either monounsaturated or polyunsaturated

Fatty acids with double bonds are unsaturated - either monounsaturated (1 double bond) or polyunsaturated (more than one double bond) Unsaturated fatty acids are bent in structure, originate from plant sources (i.e. oils) and are typically liquid at room temperatures

Structure and function of glycogen in humans

Glycogen is an energy storage polysaccharide formed in the liver in animals. It is composed of α-glucose subunits linked together by both 1-4 linkages and 1-6 linkages (branching) It is like amylopectin in plants, but is more highly branched (1-6 linkages occur every ~10 subunits as opposed to ~20)

Glycolysis

Glycolysis, occurs in cytoplasm, breaks down glucose (6-C) into two molecules of pyruvate (3C), and also produces: - Hydrogen carriers (NADH) from an oxidised precursor (NAD+) - A small yield of ATP (net gain of 2 molecules)

DNA replication: Helicase

Helicase unwinds the double helix and separates the two polynucleotide strands by breaking the hydrogen bonds that exist between complementary base pairs. The two separated polynucleotide strands will act as templates for the synthesis of new complementary strands.

Health Risks of High Cholesterol (HDL & LDL)

High cholesterol levels in the bloodstream lead to the hardening and narrowing of arteries(DK: pulsåre) (atherosclerosis) When there are high levels of LDL in the bloodstream, the LDL particles will form deposits in the walls of the arteries. The accumulation of fat within the arterial walls lead to the development of plaques which restrict blood flow. If coronary arteries become blocked, coronary heart disease (CHD) will result - this includes heart attacks and strokes.

HDL, High density lipoproteins (good)

High density lipoproteins (HDL) search for excess cholesterol and carry it back to the liver for disposal. HDLs lower blood cholesterol levels ('good') - Unsaturated (cis) fats increase HDL levels within the body, lowering blood cholesterol levels

Immobilised enzymes in industry

Immobilised enzymes have been fixed to a static surface in order to improve the efficiency of the catalysed reaction. Enzyme concentrations are conserved as the enzyme is not dissolved - hence it can be retained for reuse. Separation of the product is more easily achieved as the enzyme remains attached to the static surface Examples: Biofuels - Enzymes are used to breakdown carbohydrates to produce ethanol-based fuels Medicine - Enzymes are used to identify a range of conditions, including certain diseases and pregnancy Biotechnology - Enzymes are involved in a number of processes, including gene splicing Food production - Enzymes are used in the production and refinement of beers and dairy products Textiles - Enzymes are utilised in the processing of fibres (e.g. polishing cloth) Paper - Enzymes assist in the pulping of wood for paper production

Rate of enzyme activity and substrate concentration

Increasing substrate concentration will increase the activity of a corresponding enzyme. More substrates mean there is an increased chance of enzyme and substrate colliding and reacting within a given period. After a certain point, the rate of activity will cease to rise regardless of any further increases in substrate levels. This is because the environment is full with substrate and all enzymes are bound and reacting (Vmax)

Life is based on carbon compounds including lipids

Lipids - Non-polar, hydrophobic molecules which may come in a variety of forms (simple, complex or derived) - Lipids serve as a major component of cell membranes (phospholipids and cholesterol) - They may be utilised as a long-term energy storage molecule (fats and oils). Also may function as a signalling molecule (steroids)

LDL, Low density lipoproteins (bad)

Low density lipoproteins (LDL) carry cholesterol from the liver to the rest of the body. - Saturated fats increase LDL levels within the body, raising blood cholesterol levels - Trans fats increase LDL levels and decrease HDL levels within the body, significantly raising blood cholesterol levels

Analysis of Meselson and Stahl's results to obtain support for the theory of semi-conservative replication of DNA

Meselson and Stahl were able to experimentally test the v three models using radioactive isotopes of nitrogen. Nitrogen is component of DNA and can exist as a heavier 15N or a lighter 14N. DNA molecules were prepared using the heavier 15N and then triggered to replicate in the presence of lighter 14N. DNA samples were then separated via centrifugation to determine the composition of DNA in the replicated molecules. After one division, DNA molecules were found to contain a mix of 15N and 14N, disproving the conservative model. After two divisions, some molecules of DNA were found to consist solely of 14N, disproving the dispersive model. The results supported the semi-conservative model of DNA replication.

Metabolism is the web of all the enzyme-catalysed reactions in a cell or organism

Metabolism describes the totality of chemical processes that occur within a living organism in order to maintain life. It is the web of all enzyme-catalysed reactions that occur within a cell or organism. Metabolic reactions serve two key functions: -They provide a source of energy for cellular processes (growth, reproduction, etc.) - They enable the synthesis and assimilation of new materials for use within the cell

Comparison of the thermal properties of water with those of methane

Methane (CH4) and water have many similarities in structures: - Comparable size and weight (H2O = 18 dalton ; CH4 = 16 dalton) - Comparable valence structures (both have tetrahedral orbital formations, but water is bent due to unbonded electron pairs) The differences in thermal properties between water and methane arise from differences in polarity between the molecules: - Water is polar and can form intermolecular hydrogen bonds (due to high electronegativity of oxygen atom) - Methane is non-polar and can only form weak dispersion forces between its molecules (carbon has a lower electronegativity) - This means water absorbs more heat before changing state (each H-bond has an average energy of 20 kJ/mol) - Water has a significantly higher melting and boiling point - Water has a higher specific heat capacity (energy required to raise the temperature of 1 g of substance by 1ºC) - Water has a higher heat of vaporisation - Water as a higher heat of fusion (energy required to be lost to change 1 g of liquid to 1 g of solid at 0ºC)

Molecular biology explains living processes in terms of the chemical substances involved

Molecular biology is the study focuses on investigating biological activity at a molecular level This includes enlightenment of structure and function of chemical substances and determining their interactions as parts of living processes. Biological processes are tightly regulated by enzymes, whose expression is controlled by gene activation (DNA) Changes in activity are typically determined by signalling molecules (either endogenous or exogenous in origin)

Life is based on carbon compounds including nucleic acids

Nucleic Acids -Genetic material of all cells and determines the inherited features of an organism - DNA functions as a master code for protein assembly, while RNA plays an active role in the production of proteins

DNA Structure: Double Helix

Nucleic acids are composed of nucleotide monomers which are linked into a single strand via condensation reactions: The phosphate group of one nucleotide attaches to the sugar of another nucleotide (at the 3'- hydroxyl (-OH) group). Resulting in a phosphodiester bond forming between the two nucleotides (and water is produced as a by-product). Successive condensation reactions result in the formation of long polynucleotide strands. - Adenine (A) pairs with Thymine (T) via two hydrogen bonds - Guanine (G) pairs with Cytosine (C) via three hydrogen bonds In order for the bases to be facing each other and thus able to pair, the strands must be running in opposite directions (antiparallel) As the antiparallel chains lengthen, the atoms will organise themselves into the most stable energy configuration. This atomic arrangement results in the double-stranded DNA forming a double helix (~10 - 15 bases per twist)

PCR (polymerase chain reaction)

PCR is an artificial method of replicating DNA in lab. PCR is used to amplify large quantities of a specific sequence of DNA from an initial minute sample. Each PCR reaction doubles the amount of DNA - a standard PCR sequence of 30 cycles creates over 1 billion copies (230) The reaction occurs in a thermal cycler and uses variations in temperature to control the replication process: 3 steps Denaturation - DNA sample is heated (~90ºC) to separate the two strands Annealing - Sample is cooled (~55ºC) to allow primers to anneal (primers designate sequence to be copied) Elongation - Sample is heated to the optimal temperature for a heat-tolerant polymerase (Taq) to function (~75ºC)

Amino acids

Proteins are comprised of long chains of recurring monomers called amino acids. Amino acids all share a common basic structure, with a central carbon atom bound to: - An amine group (NH2) - A carboxylic acid group (COOH) - A hydrogen atom (H) - A variable side chain (R) There are 20 different amino acids which are universal to all living organisms. A further two - selenocysteine(e.g. humans) and pyrrolysine (e.g. bacterias) - modified variants found only in certain organisms

Life is based on carbon compounds including proteins

Proteins: - Make over 50% of the dry weight of cells; are composed of C, H, O and N atoms (some may include S) - Major regulatory molecules involved in catalysis (all enzymes are proteins) -May also function as structural molecules or play a role in cellular signalling (transduction pathways)

quaternary amino acid structure

Quaternary structures are found in proteins that consist of more than one polypeptide chain linked together. Alternatively, proteins may have a quaternary structure if they include inorganic artificial groups as part of their structure. Not all proteins will have a quaternary structure - many proteins consist of a single polypeptide chain Example of quaternary= haemoglobin (O2 carrying molecule in red blood cells) - Haemoglobin is composed of four polypeptide chains (two alpha chains and two beta chains) - It is also composed of iron-containing haeme groups (artificial groups responsible for binding oxygen)

The Genetic Code (Wheel)

Read from inside and out

Unsaturated fatty acids: trans isomers

The hydrogen atoms attached to the carbon double bond are on different sides of carbon. Trans fatty acids do not commonly occur in nature and are typically produced by an industrial process called hydrogenation. Trans fatty acids are generally linear in structure (despite being unsaturated) and are usually solid at room temperature

translation mnemonic (Mr Cat App)

The key components of translation are: Messenger RNA (goes to...) Ribosome (reads sequence in ...) Codons (recognised by ...) Anticodons (found on ...) Transfer RNA (which carries ...) Amino acids (which join via ...) Peptide bonds (to form ...) Polypeptides

Structure and function of starch in plants (polymers)

Starch is an energy storage polysaccharide found in plants. It is composed of α-glucose subunits (bound in a 1-4 arrangement) and exists in one of two forms: - Amylose is a linear (helical) molecule while amylopectin is branched (contains additional 1-6 linkages) - Amylose is harder to digest and less soluble, however, as it takes up less space, is the preferred storage form in plants

Hydrophobic

Substances that do not freely associate or dissolve in water are characterised as hydrophobic ('water-hating') Hydrophobic substances examples: - large, non-polar molecules (such as fats and oils)

Hydrophilic

Substances that freely associate and dissolve in water are characterised as hydrophilic ('water loving') Hydrophilic substances examples: - all polar molecules and ions

Taq polymerase in PCR

Taq polymerase is an enzyme isolated from the thermophilic bacterium Thermus aquaticus. As this enzyme's optimal temperature is ~75ºC, it is able to function at the high temperatures used in PCR without denaturing. Taq polymerase extends the nucleotide chain from the primers - therefore primers are used to select the sequence to be copied.

1953, Crick and Watson's elucidation of the structure of DNA using model making

The British scientists constructed models to quickly visualise and assess the viability of potential structures based on discoveries: - DNA is composed of nucleotides - Phoebus Levene, 1919 - DNA is composed of equal no. of purines (A + G) and pyrimidines (C + T) - Erwin Chargaff, 1950 - DNA is organised to helical structure - Rosalind Franklin, 1953 (data shared without permission) DNA model showed: - DNA strands = antiparallel and double helix - DNA strands pair via complementary base pairing (A = T ; C Ξ G) - Outer edges of bases remain exposed (allows access to replicative and transcriptional proteins) Model based on trail and error: - first model generated was triple helix - Early models had bases on the outside and sugar-phosphate residues in the centre - Nitrogenous bases were not initially configured correctly meaning not show complementarity

Active site of an enzyme

The active site is the region on the surface of the enzyme which binds to the substrate molecule. The active site and the substrate complement each other in shape and chemical properties. Meaning only a specific substrate is capable of binding to a particular enzyme's active site

Codons

The base sequence of an mRNA molecule encodes the production of a polypeptide. The mRNA sequence is read by the ribosome in triplets of bases called codons. Like three letters. Each codon codes for one amino acid with a polypeptide chain. Meaning: The order of the codons in an mRNA sequence determines the order of amino acids in a polypeptide chain

Significance of Cohesive and Adhesive Properties:

The cohesive properties of water explain its surface tension - The hydrogen bonding between water molecules allows the liquid to resist low levels of external force (surface tension) - The high surface tension of water makes it sufficiently dense for certain smaller organisms to move along its surface The adhesive properties of water explain its capillary action - Attraction to charged or polar surfaces (e.g. glass) allows water to flow in opposition of gravitational forces (capillary action) - This capillary action is necessary to allow water to be transported up plant stems via a transpiration stream

Hydrogen bonding and dipolarity explain properties of water

The dipolarity of a water molecule enables it to form polar associations with other charged molecules (polar or ionic) Water can form hydrogen bonds with other water molecules (between a δ+ hydrogen and a δ- oxygen of two molecules)

Use of water as a coolant in sweat

The evaporation of water as sweat is a fundamental mechanism employed by humans as a means of cooling down: homeostasis - Evaporation requires an input of energy - This energy comes from the surface of the skin when it is hot, therefore when the sweat evaporates the skin is cooled. Because water has a high specific heat capacity, it absorbs a lot of thermal energy before it evaporates. - Thus water functions as a highly effective coolant, making it the principal component of sweat

The Rosalind Franklin Controversy

The final construction of correct DNA owed heavily to the X-ray crystallography data generated by Franklin. This data confirmed the arrangement of the DNA strands into a helical structure. The data was shared without Franklin's knowledge or permission and contributed profoundly to the final design. Hence, Franklin is now recognised as a key contributor to the elucidation of DNA structure

Genetic Code

The genetic code is the set of rules by which information encoded within mRNA sequences is converted into amino acid sequences (polypeptides) by living cells. The genetic code identifies the corresponding amino acid for each codon combination. As there are four possible bases in a nucleotide sequence, and three bases per codon, there are 64 codon possibilities (43). The coding region of an mRNA sequence always begins with a START codon (AUG) and terminates with a STOP codon.

Unsaturated fatty acids: cis isomers

The hydrogen (H) atoms attached to the carbon double bond are on the same side(from carbon)

Collision frequency for enzyme catalysis

The rate of enzyme catalysis can be increased by improving the frequency of collisions via: - Increasing the molecular motion of the particles (thermal energy can be introduced to increase kinetic energy) - Increasing the concentration of particles (either substrate or enzyme concentrations)

Gene

The sequence of DNA that is transcribed into RNA is called a gene. - The strand that IS transcribed is called the antisense strand and is complementary to the RNA sequence. - The strand that is NOT transcribed is called the sense strand and is identical to the RNA sequence (with T instead of U) Transcription of genes occur in the nucleus (where DNA is), before the RNA moves to the cytoplasm (for translation)

tertiary amino acid structure: three-dimensional configuration of protein

The tertiary structure of a polypeptide chain will be determined by the interactions between the variable side chains (R) These interactions may include hydrogen bonds, disulphide bridges, ionic interactions, polar associations, etc. The affinity or repulsion of side chains will affect the overall shape of the polypeptide chain and are determined by the position of specific amino acids within a sequence Hence, the order of the amino acid sequence (primary structure) determines all subsequent levels of protein folding

Modes of transport of glucose, amino acids, cholesterol, fats, oxygen and sodium chloride in blood in relation to their solubility in water

The transport of molecules within the bloodstream will depend on their solubility in water. Water soluble substances will usually be able to travel freely in the blood plasma, whereas water insoluble substances cannot Water Soluble Substances - Sodium chloride (NaCl) - Oxygen - Glucose - Amino acids Water Insoluble Substances - Lipids (fats and cholesterol)

What is mRNA?

There are different types of RNA. One type of RNA is known as mRNA(messenger RNA). mRNA is RNA that is read by ribosomes to build proteins. While all types of RNA are involved in building proteins, mRNA is the one that actually acts as the messenger.

Transcription

Transcription is the process by which an RNA sequence is produced from a DNA template. Process: - RNA polymerase separates the DNA strands and synthesises a complementary RNA copy from one of the DNA strands. - When the DNA strands are separated, ribonucleoside triphosphates align opposite their exposed complementary base partner. - RNA polymerase removes the additional phosphate groups and uses the energy from this splitting to covalently join the nucleotide to the growing sequence. - Once the RNA sequence has been synthesised, RNA polymerase detaches from the DNA molecule and the double helix reforms

Translation (overview)

Translation is the process of protein synthesis in which the genetic information encoded in mRNA is translated into a sequence of amino acids on a polypeptide chain.

(lipid) Triglycerides formation

Triglycerides are the largest class of lipids and function as long-term energy storage molecules. Animals store triglycerides as fats (solid), plants store triglycerides as oils (liquid). Triglycerides are formed by condensation from three fatty acids and one glycerol. The hydroxyl groups of glycerol combine with the carboxyl groups of the fatty acids to form an ester linkage. This condensation reaction results in the formation of three molecules of water. Triglycerides can be either saturated or unsaturated, depending on the composition of the fatty acid chains.

Falsifying Vitalism : Urea as an example of a compound that is produced by living organisms but can also be artificially synthesised

Vitalism was a believe that dictated that organic molecules could ONLY be synthesised by living systems. It was believed that living things possessed a certain "vital force" needed to make organic moleculeS. Meaning organic compounds were thought to have a non-physical element lacking from inorganic molecules. Vitalism as a theory has since been disproven with the discovery that organic molecules can be artificially synthesised. In 1828, Frederick Woehler heated an inorganic salt (ammonium cyanate) and produced urea. Urea is a waste product of nitrogen metabolism and is eliminated by the kidneys in mammals. The artificial synthesis of urea demonstrates that organic molecules are NOT fundamentally different to inorganic molecules

Water molecules are polar and hydrogen bonds form between them

Water = two hydrogen atoms covalently bonded to an oxygen atom (H2O) While this covalent bonding involves the sharing of electrons, they are not shared equally between the atoms. Oxygen (due to having a higher electronegativity) attracts the electrons more strongly. The shared electrons orbit closer to the oxygen atom than the hydrogen atoms resulting in polarity. Water is polar as it has charge difference across the different poles of the molecule. The oxygen atom is slightly negative (δ-) while the hydrogen atoms are slightly positive (δ+) This charge difference across (dipole) allows water to form weak associations with other polar molecules. The slightly negative poles (δ-) will attract the slightly positive poles (δ+) of other molecules, and vice versa. When a δ+ hydrogen atom is attracted to a δ- fluorine, oxygen or nitrogen atom of another molecule, it forms a hydrogen bond. Hydrogen bonds are relatively stronger than other polar associations.

Hydrogen bonding and dipolarity explain the thermal properties of water

Water has the capacity to absorb significant amounts of heat before changing state. This is due to the extensive hydrogen bonding between water molecules - the H-bonds need to be broken before a change in state can occur and this requires the absorption of energy (heat) Consequently, water is an excellent medium for living organisms as it is relatively slow to change temperature and thus supports the maintenance of constant conditions (internal and external)

Hydrogen bonding and dipolarity explain the cohesive and adhesive properties of water

Water has the capacity to form intermolecular associations with molecules that share common properties Because water is polar it will be attracted to other molecules that are polar or have an ionic charge Cohesive Properties: - Cohesion is the ability of like molecules to stick together - Water is strongly cohesive (it will form hydrogen bonds) Adhesive Properties: - Adhesion is the ability of dissimilar molecules to stick together - Water will form intermolecular associations with polar and charged molecules

Hydrogen bonding and dipolarity explain the solvent properties of water

Water is referred to as the universal solvent due to its capacity to dissolve a large number of substances. Water can dissolve any substance that contains charged particles (ions) or electronegative atoms (polarity) This occurs because the polar attraction of large quantities of water molecules can sufficiently weaken intramolecular forces (such as ionic bonds) and result in the dissociation of the atoms The slightly charged regions of the water molecule surround atoms of opposing charge, forming dispersive hydration shells

nitrogenous base pairing

can only pair with its complementary partner: Adenine (A) pairs with thymine (T) Cytosine (C) pairs with guanine (G)

BMI (body mass index)

a measure of body weight relative to height formula: BMI= mass in kg/ height in m ^2

Scientific evidence for health risks of trans fats and saturated fatty acids (blood cholesterol levels)

cis fat= good (cis) unsaturated fats lower blood cholesterol levels. trans and saturated fat= bad Saturated and trans fats raise blood cholesterol levels. Fats and cholesterol cannot dissolve in blood and are consequently packaged with proteins (to form lipoproteins) for transport bad: Low density lipoproteins (LDL) carry cholesterol from the liver to the rest of the body. good: High density lipoproteins (HDL) scavenge excess cholesterol and carry it back to the liver for disposal. - Saturated fats increase LDL levels within the body, raising blood cholesterol levels - Trans fats increase LDL levels and decrease HDL levels within the body, significantly raising blood cholesterol levels - Unsaturated (cis) fats increase HDL levels within the body, lowering blood cholesterol levels

CHD

coronary heart disease

Protein functions in cell: Rubisco, insulin, immunoglobulins, rhodopsin, collagen and spider silk as examples of the range of protein functions

functions within a cell: Mnemonic: SHITS ME Structure: - Collagen: A component of the connective tissue of animals - Spider silk: A fiber spun by spiders and used to make webs (by weight, is stronger than kevlar and steel) Hormones: - Insulin: Protein produced by the pancreas and triggers a reduction in blood glucose levels - Glucagon: Protein produced by the pancreas that triggers an increase in blood glucose levels Immunity: - Immunoglobulins: Antibodies produced by plasma cells that are capable of targeting specific antigens Transport: - Haemoglobin: A protein found in red blood cells that is responsible for the transport of oxygen - Cytochrome: A group of proteins located in the mitochondria and involved in the electron transport chain Sensation: - Rhodopsin: A pigment in the photoreceptor cells of the retina that is responsible for the detection of light Movement: - Actin: Thin filaments involved in the contraction of muscle fibres - Myosin: Thick filaments involved in the contraction of muscle fibres Enzymes: - Rubisco: An enzyme involved in the light independent stage of photosynthesis

glycosidic linkage

glycosidic linkage is a type of covalent bond that joins a carbohydrate molecule to another

Deducing the DNA base sequence for the mRNA strand.

mRNA → DNA mRNA is a complementary copy of a DNA segment (gene) and consequently can be used to deduce the gene sequence.For converting a sequence from mRNA to the original DNA code, apply the rules of complementary base pairing: Cytosine (C) is replaced with Guanine (G) - and vice versa Uracil (U) is replaced by Adenine (A) Adenine (A) is replaced by Thymine (T) Example: (mRNA) AUG CCA GUG ACU UCA GGG ACG AAU GAC UUA Answer: (DNA) TAC GGT CAC TGA AGT CCC TGC TTA CTG AAT

The Genetic Code (Grid)

mRNA → Polypeptide Example: (mRNA) GUAUGCACGUGACUUUCCUCAUGAGCUGAU Answer: (codons) GU AUG CAC GUG ACU UUC CUC AUG AGC UGA U Answer: (amino acid) Met His Val Thr Phe Leu Met Ser STOP