bio finals - semester 2
What number is a sister chromatid?
1
Teams of computer scientists and biology students work together to develop a simulated experiment on mutations in mice. The simulation is programmed with the complete sequence of mouse DNA. Then it calculates the frequency of mutations under three conditions: when the mice are subjected to tobacco smoke, subjected to ultraviolet radiation, and kept under normal conditions. For each mutation, the simulation identifies whether the mutation affects a mouse protein. The biology students prepare the data table shown below to organize the results of the simulation. An expected result of the simulation is that the frequency of mutations under normal conditions is about 1 in every ____________ base pairs of DNA. In the presence of tobacco smoke or ultraviolet light, the frequency of mutations will ____________.
10 million, increase
If 35% of an organism's DNA is thymine, what is the percentage of guanine?
15%
Which number is the centromere?
2
A cubed cell with sides of 3 cm are observed. What is its ratio?
2:1
How many different gametes can be produced by a tall, yellow-seeded, pea plant (TtYy)?
4
Raphael runs a computer simulation of a population of beetles in a garden ecosystem. The simulation begins with 300 beetles, divided equally among red, tan, and brown variants, and with equal numbers of males and females. The simulation assumes that female beetles each lay 50 eggs in each reproduction cycle, and that individual beetles live for at most 2 reproductive cycles. The table shows the numbers of each beetle variant over 7 reproduction cycles. Only adult beetles are counted. Which conclusions about the simulated beetle population does the data support? Select two answer choices.
A new adaptation for the beetles appeared during the simulation.
Edwin is studying a population of rabbits in the neighborhood that surrounds his home. He observes a variety of fur colors among the rabbits, including gray, white, and brown. The rabbit fur also has a variety of markings, including spots and bands.Edwin argues that natural selection will occur on the rabbit population. It will result in a change in the distribution of fur colors and markings.Which observation would provide the STRONGEST evidence in support of Edwin's argument?
A new predator tends to hunt more white rabbits than gray or brown rabbits.
What is a cyclin?
A protein found in mitotic cells that regulate cell division.
One dog is heterozygous for black fur (Bb), and its mate is homozygous for blonde fur (bb). What is the probability of one of their puppies having black fur? Explain. Show Punnett square by inserting a table or copying the one below:
BbbBbbbbBbbb There is a 1 out of 2 chance the puppies will have black fur.
How does the double-helical structure of DNA explain how the DNA molecules can be copied or replicated?
Because of base pairing, each strand has all the information to serve as a template for the other strand.
Briefly describe binary fission. How does it compare to mitosis?
Binary fission is a form of asexual reproduction. Mitosis is cell division and used to create two identical daughter cells. They both are forms of asexual reproduction, just different methods.
DeMarco is comparing the bodies of a typical bird and winged insect, as shown in the diagram. Identify the choice that best completes the statement or answers the question. DeMarco researches a variety of evidence about birds and insects. He concludes that birds and insects are very distant relatives, yet they still have a common ancestor. Which two statements provide the STRONGEST evidence for DeMarco's conclusion? Select two answer choices.
Both birds and insects use the same genetic code. Both birds and insects use DNA and RNA to transmit genetic information
How do we count chromosomes?
By their centromeres
The sequence of nitrogenous bases on a portion of a strand of DNA is listed below. From left to right, what is the corresponding sequence of the complementary strand? GGTGACT
C C A C T G A
Analyze the cell cycle diagrams of two different types of cells. Compare and contrast the length of time each cell takes to complete the G1 phase of the cycle. The two cells are provided with nutrients for growth. After 35 hours, which is the most likely observation of the cells?
Cell 2 has divided twice, while Cell 1 has divided once.
How are broken bones healed?
Cells at the edge of the injury are stimulated to divide quickly. As the injury heals, the cells growth are slowed
A population of male and female goats is stranded on a large island. The goats differ from one another in several ways, including fur color, ear shape, and preferred food.A scientist predicts that the average ear shape of the goats will change gradually over time. According to Darwin's ideas about evolution and natural selection, the accuracy of the prediction depends on which of these conditions?
Certain ear shapes help the goats survive and reproduce on the island.
How does the structure of DNA support Chargaff's Rule of base pairing?
DNA is double stranded, and hydrogen bonds between base pairs hold the strands together.
When must DNA replication occur during the cell cycle for each daughter cell to receive a complete copy of DNA?
DNA replication must occur before mitosis in interphase.
Scientists before Darwin had proposed that living things could change over time. Why was Darwin's theory of evolution more powerful and useful than the proposals of the other scientists?
Darwin explained the mechanism by which evolution occurred
What would happen if a cell divides before DNA replication is completed?
Daughter cells would receive incomplete genetic information and never regain it, and they may not survive.
Compare and contrast haploid and diploid cells. Tell me what haploid and diploid mean, and how the cells are different and/or similar to each other. Also include chromosome counts and which are gametes.
Diploid cells contain both sets of homologous chromosomes, or 46 chromosomes. They don't have gametes. Haploid cells contain only one set of chromosomes or 23 chromosomes. They are gametes. They are only different by the number of chromosomes and the resulting number of cells at the end of the cycle.
Giraffes, camels, and horses share some traits, although they vary in other traits. Which statement accurately describes the evolution of these species?
Each species descended from an ancient common ancestor.
The individual who took the X-ray diffraction photograph in Watson & Crick's published Nobel Prize winning paper on the structure of DNA was....
Franklin
A scientist hypothesizes that the markings in a certain species of frog can be altered by epigenetic mechanisms. Which of these observations would provide the strongest evidence for this hypothesis?
Genetically identical frogs develop different markings when placed in different environments.
Which is correct about metaphase 1 of meiosis compared to metaphase of mitosis?
Homologous chromosomes lining up in the middle
Artificial selection has produced a wide variety of crop plants, livestock, and pets. Which characteristic of artificial selection makes it different from natural selection?
Humans, not the environment, select which organisms survive and reproduce.
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include?
Identify promoter and "stop" regions on the DNA molecule.
The genotype of plants with the recessive phenotype of wrinkled seeds is always homozygous. However, when an individual plant expresses the dominant phenotype of round seeds, it can have either the genotype RR or Rr. How could you test whether the dominant individual is a true breeder (RR)? Explain.
If the dominant individual is a true breeder, then there will be a 50% chance that the offspring would be a purebreed. If it's not, then there is a 25% chance that the offspring would a purebreed.
Explain what is the same and what is different about the end result of both mitosis and meiosis.
In Mitosis, the result is 2 daughter cells and 46 chromosomes. Since there is no crossing-over, there is less genetic diversity. They will become cells that replace other cells throughout the body. In Meiosis, the result is 4 daughter cells and 23 chromosomes. Since there is crossing-over in Meiosis, the resulting cells will have genetic variety. They will become sperm and egg cells.
How does DNA replication differ between eukaryotes and prokaryotes?
In prokaryotes, DNA replication starts at one point and proceeds in both directions. In eukaryotes, it starts at multiple points.
In cattle, if a red animal is crossed with a white one, a mixture of red and white color, called roan, is produced in the F1 generation. Crosses between animals in the F1 generation produce white, roan, and red cattle. Describe the pattern of inheritance in these types of cattle.
Incomplete Dominance
What is the function of the protein that is bound to the operator region on a strand of RNA?
It is a repressor protein that stops transcription from occurring.
The diagram shows a portion of the genetic code. The diagram is read from the center of the circle outwards. So, the codon AGU is translated as serine, which is an amino acid. Identify the choice that best completes the statement or answers the question. Which conclusion about the genetic code is most strongly supported by the evidence presented in the diagram?
Many amino acids, although not all of them, may be encoded by more than one codon.
A point mutation changes a codon in an mRNA molecule. Will the mutation affect the polypeptide that forms? Why?
Maybe. Some pairs of codons are translated into the same amino acid
What is the phase of cell division shown above?(spider like structures on the outer parts of the cell with the crosses in the middle and still together)
Metaphase
Darwin developed and proposed the Theory of Evolution during the 1800s. Since that time, due in part to advances in technology, scientists have expanded their knowledge and ideas about biological systems. Which statement describes an example of evidence acquired in the past 100 years and its relationship to the Theory of Evolution?
New evidence from molecular biology provides overwhelming support that all life evolved from a single ancestor.
Coat color in rabbits is inherited by multiple alleles for a single gene. The table describes the alleles and their inheritance. Would it be possible to obtain a rabbit with Chinchilla coat color if one parent is white and the other parent has a Himalayan coat color?
No, because the parents have no alleles for Chinchilla.
What is different about telophase of mitosis and telophase 1 of meiosis?
Nothing, the processes are the same
Read each of the sentences that describe phases of the cell cycle. The match the description to the correct phase listed below.
Organelles and materials needed for cell division are made = G2 Cell begins to grow = G1 Cell Division = M Genetic Material is copied = S
John states the following claim."Biogeography provides evidence for the theory of evolution."To support this claim, which evidence would be MOST useful for John to cite?
Polar bears and grizzly bears are similar in many ways, but are adapted to live in different regions.
Explain the roll of DNA Polymerase. What does it do, and in which direction along the DNA does it run?
Polymerase only moves in one direction along its template strand in the 5' to 3' direction.
What is the phase pictured above? (purple with the crosses in the middle)
Prophase
When does crossing-over occur?
Prophase 1
Tell me what is the same and/or different in all of the steps in mitosis compared to all of the steps in meiosis 2. You may compare and contrast them as a list or in a sentence format.
Prophase: The nucleus condenses and chromosomes become visible and are duplicated. Prophase 2: No DNA replication and chromosomes do not for tetrads. Metaphase/Metaphase 2: The chromosomes line up in the center of the cell in both stages. Anaphase/Anaphase 2: The chromatids separate and are pulled away to opposite poles. Telophase/Telophase 2: The cell divides into daughter cells. Cytokinesis: The daughter cells are fully formed.
The diagram shows a model of DNA replication Which of the following labels should NOT be added to the model?
RNA polymerase
A molecular biologist is developing a computer model of the transcription of a gene into RNA. Which event should be included in the model before transcription occurs?
RNA polymerase binding to a region near the gene, called the promoter
Which of the following events occurs in DNA replication in prokaryotes?
Replication starts from a single point and proceeds in two directions until the entire chromosome is copied.
Robert is studying a long list of letters. The letters represent the order of nitrogenous bases in a molecule of mRNA. The first several bases in the list are shown below. AUGCCACAGGUUCAUCCGAA... To identify the amino acid sequence encoded by the mRNA, which would be the most useful first step for Robert to follow?
Separate the list into three-letter "words."
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question .A student claims that the mRNA will include the following base sequence. UUGGUCCGGUACCUGGAAAUAUAUUUGAUCCUA The researcher argues the student's claim is faulty. The mRNA likely will not include the sequence that the student proposes.Which features of transcription support the researcher's argument? Choose the two statements that apply.
Sequences called introns are removed from pre-mRNA. Only some base sequences in a DNA molecule are transcribed into mRNA.
The diagram describes a proposed evolutionary relationship among three ancient species, all of which were relatives of modern whales. Identify the choice that best completes the statement or answers the question. The diagram supports which of these conclusions about the three ancient species?
Similar body parts among the three species, such as the mouth, legs, and tail, are examples of homologous structures.
Which is correct about anaphase of mitosis compared to anaphase 1 of me
Sister chromatids are pulled apart.
Raphael runs a computer simulation of a population of beetles in a garden ecosystem. The simulation begins with 300 beetles, divided equally among red, tan, and brown variants, and with equal numbers of males and females. The simulation assumes that female beetles each lay 50 eggs in each reproduction cycle, and that individual beetles live for at most 2 reproductive cycles. The table shows the numbers of each beetle variant over 7 reproduction cycles. Only adult beetles are counted. The simulation is able to model the natural selection of a beetle population for which of these reasons? Select all of the answers that apply.
Some beetle variants were more likely to survive and reproduce than other variants. Only a small fraction of beetle eggs hatched, grew into adults, and reproduced.
Charles Darwin applied a wide variety of observations to help him develop his ideas about evolution. Which general statement describes several of the observations that Darwin made and considered, and later incorporated into his Theory of Evolution?
Species on islands tend to resemble mainland species, yet differ from them in many ways.
A gardener crosses a true-breeding tall tomato plant with a true-breeding dwarf tomato plant. In tomatoes, tall vine (T) is dominant to dwarf vine (t).Predict the phenotypes and genotypes of the F1 generation using Punnett Squares.
TTtTtTttTtTt There are all hybrid tall tomato plants with genotype Tt.
What is the phase of cell division pictured above? (blue and there are two nuclei in the middle of the cell)
Telophase
Darwin collected and studied a variety of fossils. The fossils provided clues to ancient organisms. As Darwin concluded, how did ancient organisms compare to modern species?
The ancient organisms were similar to modern species, but differed in several ways.
A molecule of tRNA includes a sequence of three nitrogenous bases called an anticodon. What is the role of the anticodon in the process of translation?
The anticodon binds to a codon on mRNA
Which of the following happens when cancer occurs?
The control of the cell cycle is impaired
A scientist argues that the hair of mammals and the feathers of birds are analogous structures. If the scientist is correct, what is the evolutionary relationship between hair and feathers?
The evolution of hair in mammals occurred independently of the evolution of feathers in birds.
On his visit to the Galapagos Islands, Darwin observed a variety of similar birds that lived either on the ground or in trees. Later, experts classified these birds as finches. Darwin had identified 14 distinct finch species, each different from one another and different from finch species that lived on the mainland. The diagram shows four of the Galapagos finches, each of which has a different type of beak. The insets compare the beaks to a type of tool. Identify the choice that best completes the statement or answers the question. According to Darwin's theory of evolution, each beak shape is the result of the process of natural selection. Which statement is MOST USEFUL for explaining why different beak shapes evolved in each of the four finch species?
The food supply selected for beak shape as the finch species descended from a common ancestor.
Many genetic technologies involve the transferring of genes from one organism to another. For example, a gene in human DNA codes for the production of insulin, an important protein. This gene has been transferred to bacterial DNA, where it remains functional. The bacteria produce human insulin that can be harvested and given to people who lack sufficient insulin supplies. Which property of molecular genetics is most useful for explaining the success of the technology used to manufacture insulin?
The genetic code is identical in nearly all organisms.
Red blood cells carry antigens on their surfaces coded for by alleles of the gene designated by the letter I. IA is dominant to i and produces antigen A on the surface of red blood cells. The IB allele is also dominant to the i allele and produces antigen B on the surface of red blood cells. The i allele does not produce surface antigens. What types of inheritance are represented by the genetics of human blood types? Select all of the answers that apply.
The human blood type gene is an example of a gene with multiple alleles, IA, IB, i. IA and IB show incomplete dominance because both alleles are partially expressed in blood type A and B.
The bonds that hold the two strands of DNA together come from...
The hydrogen bonds between nitrogenous base
Alvin is studying a model of the chemical structure of a common nucleic acid. He observes that the nucleic acid consists of four nitrogenous bases: adenine (A), cytosine (C), guanine (G), and uracil (U). Alvin's observation most strongly supports which of these conclusions?
The nucleic acid is a form of RNA, and is not DNA.
If a cubed cell with 2-cm sides (2x2x2) doubles the dimensions of its sides, what change will occur to the ratio of its surface area to volume?
The ratio is halved.
The adaptations of a pelican include its long, pouch-like beak. Why is the beak of the pelican an example of an adaptation?
The shape and structure of the beak are inherited and help the pelican survive in its environment.
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Scientists have observed that the same gene may produce several different mRNA molecules. How could the researcher's model show this variety of mRNA molecules? When does the introduction of this variety happen?
The stage of introns being removed, then exons splicing together can create a variety of tRNA molecules.
DeMarco is comparing the bodies of a typical bird and winged insect, as shown in the diagram. Identify the choice that best completes the statement or answers the question. DeMarco is constructing an argument that the wings of the bird and insect are analogous structures. Which statement provides the STRONGEST evidence for this argument?
The two types of wings grow and develop from different embryonic tissues.
The wing of a bird and the front limb of a mammal have a similar number and arrangement of bones. Which evolutionary relationship explains these similarities?
The wing and front limb are homologous structures; each evolved from a common ancestor.
Which analogy best describes the role of homeotic genes, which are found in many organisms?
They act like a switch for initiating a pattern of development and cell differentiation.
In eukaryotic cells, how do transcription factors act to control gene expression?
They bind to regulatory regions of DNA near the genes.
Which of the following statements are typical for cancer cells? Select all that apply.
They have defective genes. They may form tumors that metastasize.
Read each statement and determine if relates to Cell division or Apoptosis.
This process decreases the number of body cells. = Apoptosis This process causes death of abnormal cells. = Apoptosis This process regulates the cell cycle. = Apoptosis This process increases number of body cells = Cell Division This process repairs injuries. = Cell Division
Mendel studied 7 traits in pea plants. One of the monohybrid crosses he made was between plants with round seeds (R) and plants with wrinkled seeds (r). What was a conclusion that Mendel drew from the F2 generation of this cross?
Three fourths of the F2 plants show the round seed phenotype and carry the dominant allele for roundness.
What is the purpose of crossing over?
To create genetic diversity. When combining a sperm and egg cell, crossing-over is the reason that children look similar to their parents and not completely identical to their siblings.
A geneticist crossed tall pea plants and obtained 971 tall pea plants and 315 short pea plants in the F1 generation. What were the genotypes of the parents that produced the offspring in the Punnett square shown, if T is the allele for tall, and t is the allele for short?
Tt
A gardener crosses a true-breeding tall tomato plant bearing red fruit with a true-breeding dwarf tomato plant with yellow fruit. In tomatoes, tall vine (T) is dominant to dwarf vine (t) and red fruit (R) is dominant to yellow fruit (r). Assume that the two genes controlling the "tall vine" and "red fruit" traits are on two different pairs of chromosomes. What are the possible gamete combinations?
Tt, Tr, Rt, Rr
What is crossing-over?
When homologous chromosomes trade genes
Polyploidy is a condition in which organisms have extra sets of chromosomes. Scientists have observed many examples of polyploidy in plants, including crop plants such as bananas, limes, and strawberries. What best describes polyploidy in these plants?
a chromosomal mutation that may provide benefits to an organism
The diagram describes a proposed evolutionary relationship among three ancient species, all of which were relatives of modern whales. Identify the choice that best completes the statement or answers the question. What evidence would MOST STRONGLY support the evolutionary relationship described in the diagram?
a comparison of the fossil skeletons of the species
A variety of plants and animals live in a meadow ecosystem. According to Darwin's ideas about evolution, which of these meadow organisms has the greatest fitness?
a female mouse that has many offspring
What structure is found in prokaryotic cells but not eukaryotic cells?
a single, circular DNA chromosome found in the cytoplasm
A nucleotide does NOT contain
an amino acid
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another. What is the most significant cause of cell differentiation in a multicellular organism?
differences in gene regulation and gene expression among the cells
There are three main types of RNA: messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA). Which type or types of RNA contain a copy of the instructions that a gene carries?
mRNA only
The picture of the double-helix model of the DNA molecule resembles a twisted ladder. What makes up the parts of the twisted ladder? Pick all that apply.
paired nitrogenous bases paired phosphate groups to 5 carbon sugars
A plant's stem lengths were graphed from the F1 generation. Seven categories of stem length phenotypes were observed. What pattern of inheritance is suggested by the graph?
polygenic inheritance
Teams of computer scientists and biology students work together to develop a simulated experiment on mutations in mice. The simulation is programmed with the complete sequence of mouse DNA. Then it calculates the frequency of mutations under three conditions: when the mice are subjected to tobacco smoke, subjected to ultraviolet radiation, and kept under normal conditions. For each mutation, the simulation identifies whether the mutation affects a mouse protein. The biology students prepare the data table shown below to organize the results of the simulation. What is the independent variable of the simulated experiment?
the presence of mutagens
Why do cells divide? Select all that apply.
to ensure that a cell does not become too large to replace damaged cells and tissues to produce new cells during an organism's growth
A scientist found a protein that she think is a regulatory protein. She knows that it is found in a fetus but on not inside of its cells. Is it a regulatory protein, and if so what kind?
yes, it is an external regulatory protein
A scientist from before Wallace and Darwin's time might have argued against the conclusion that birds and insects share a common ancestor. His argument might have been similar to this: "The Earth is only a couple thousand years old. Because of this, evolution would have needed to act very fast in order for birds and insects to come from the same common ancestor. Nobody has observed this happen, even at a slow rate. Counter this scientists argument, citing evidence in your counter argument to support your claim(s).
According to geologists James Hutton and Charles Lyell, the Earth is ancient and has been arounds for billions of years, due to their study of fossils and dating them. To this day, the planet is still changing and evolving, along with the species that live on it. The process of evolution is not something that happens immediately, or something that is greatly noticed. With each new generation, there is a slight difference in the species, adapting to fit their environment better. So depending on how fast the species reproduces, evolution might take only a couple of weeks, or it will not be visible at all. Lamarck's Evolutionary Hypothesis states that species are not fixed. So the best way to study evolution is to look back at the fossils and see how they similar they are to the species that are alive today. We can also observe the genetic information from the different species and use the advances in today's society to show how overwhelming the similarities of all organisms' genetic code are on the molecular level.
This figure shows a section of a double-stranded DNA molecule. What parts of the structure of DNA are explained by this model? Please select all that apply.
Adenine is paired with thymine, and guanine is paired with cytosine. Paired NUCLEOTIDES are held together by covalent bonds Paired NUCLEOTIDES are held together by hydrogen bonds at the base pairs. Correct! The two strands of DNA each have phosphate-sugar backbones
List the four nitrogenous bases and which one they match to. Use the full name of the base, DO NOT use just the letter!
Adenine=Thymine Guanine=Cytosine
The Punnett square describes the potential offspring of a cross. What phenotypes will be shown by the offspring?
All offspring will show the dominant phenotype for this trait.
A normal polypeptide includes the following sequence of amino acids. (Note: Each amino acid is named by a three-letter abbreviation.) Iso-Leu-Pro-Val-His-Ser-Thr-Met After a mutation, the amino acid sequence becomes the following: Iso-Leu-Pro-Val-Tyr-Arg-Iso-Gly Which of the following changes to a nitrogenous base in mRNA is most likely to have occurred?
An adenine (A) was removed and not replaced.
The wings of ostriches are examples of vestigial structures. The wings provide evidence for which of these evolutionary relationships?
An ancestor of ostriches had useful wings.
What is the phase of cell division pictured above? (spider like structures on the outer parts of the cell with the crosses pulled apart)
Anaphase
Compare asexual reproduction and sexual reproduction. (4 points per type of reproduction)
Asexual reproduction is when a single-celled organism produces a genetically identical offspring. Sexual reproduction is when two parents cells fuse together to create an offspring. The offspring retains genetic information from both parents.
