Biology 11-16

Process that enables a single gene to encode 2 or more polypeptides that are different in their amino acid sequence

Alternative splicing

sister chromatids separate during

Anaphase of meiosis II

consider a diploid species where n=5. if an individual of this species was found to have 11 chromosomes, it would be categorized as

Aneuploid

based on the gene and protein sequence that follow, what type of mutation-polypeptide effect has occurred normal: atggccggcccgaaagagacc mutated: atggccggcaccgaaagagacc normal protein: met-ala-gly-pro-lys-glu-thr mutated: met-ala-gly-thr-glu-arg-asp

Base addition Frame shift

Which enzyme is responsible for separating double stranded DNA into single strands

DNA helicase

During Dna replication, all the following proteins are important for separating strands and allowing movement of the replication fork except:? DNA polymerase Helicase Toposomerase Single stranded binding protein Helicase and toposomerase

DNA polymerase

What produces short sequences of RNA which allows DNA polymerese to synthesize a new strand of DNA

DNA primase

What is the function of DNA polymerase?

DNA synthesis, DNA proofreading, and removes RNA primers and fills in the gaps

bc something that has sulfur can specify the same amino acid, the genetic code is said to

Degenerate

a repair enzyme recognizes an incorrect structure in the dna and directly converts it back to a correct structure. which of the following dna repair systems is responsible for the correction

Direct repair

most human embryos that are aneuploid

Results in Down syndrome

if a pink snapdragon is self fertilized, the offsprings are red, pink, or white. what type of inheritance pattern does this show

Incomplete dominance

A mutation brought on by environmental agents is known as

Induced mutations

What are the three stages of transcription

Initiation Elongation Termination

Intervening sequences that are transcribed but not translated into proteins are called wha?

Introns

Which of the following would occur if a cell's splicesomes were mutated so they no longer functioned normally..

Introns would remain in the mature mRNA

Beginning with the simplest, which is the order of organization of genetic material

Nucleotide DNA Gene Chromosome Genome

What are the building blocks of DNA

Nucleotides

Unlike the leading strand, _____ are made in replicating the lagging strand of DNA

Okazaki fragments

A ________ bond holds the amino acids of a growing polypeptide chain together during the elongation stage of translation

Peptude

What is directly produced from the transcription of a eukaryotic gene?

Pre-mRNA

one complete turn of the double helix is composed of how many base pairs

10

How many replication forks are there in a replication bubble

2

meiosis I produces _______ and meiosis II produces ________ cells

2 haploid 4 haploid

Hw many different amino acids are found in proteins?

20

A DNA specimen that contains 30% guanine have __% thymine

20%

humans have how many different types of autosomes

22

how many nucleotides are contained in a single codon

3

the probability of obtaining a dominant phenotype from self fertilization of a heterozygous individual

3/4

consider an organism whose karyotype shows to have a total of 60 chromosomes. how many chromosomes would be contained in the sperm of this organism

30

A mrna sequence is 5' aug-ggc-acu-cau-uaa3' where aug is the start codon and uaa is the stop codon. how many distinct amino acids are required to translate the mrna sequence

4

In a tetraploid species, a cuploid individual would have how many sets of chromosomes

4

an organism that is heterozygous for two traits can produce a maximum of ____ different gametics for these traits

4

place the following events of mitosis in order 1.sister chromatids align on metaphase plate 2.cleavage furrow forms 3.nucleaus membranes break up 4.sister chromatids condense 5.sister chromatids seperate

4 3 1 5 2

if a dna template strand has a sequence of 3' tacaatgtagcc 5' then the rna produced from it will be which

5' auguuacaucgg 3'

A male is hetero for the trait that produces freckles on the skin, and he has freckles. if he marries a woman who is also hetero. for freckles, _____ percent of their children will be freckled and ______ will be hetero.

75% freckled 50% hetero

a cross between two pea plants produces a population of 732 purple and 268 white plants. what is the genotype and phenotype of the parents that produced this population

a.both parents hetero. purple

The two-factor crosses performed by Mendel support the observation that

alleles for a given trait are distributed randomly among an individual's gametes independent of the alleles for other traits

which relationship about nucleotide composition in DNA is true a.c+g=a+t b.c+a=g+t c.c=a d.g=t e.c=t

b.c+a=g+t

which of these is NOT a reason that mendel used pea plants as a model to study inheritance a.there are many varieties with distinct and different characteristics b.they cannot self fertilize c.it is easy to control cross fertilization d.the varieties he chose would show the sam evariant for a trait in generation after generation e.they have large flowers

b.they cannot self fertilize

how can you determine the genotype of a pea plant showing the dominant phenotype of purple color

cross purple plant with a white plant to see if any white plant appears

Which is NOT a criteria for an organism's genetic material? a.must contain info. necessary to construct a whole organism b.must be transmitted from parent to offspring c.to transmit the info., the gentic material must be replicated d.must be dynamic, changing rapidly in response to changes in environment e.must account for the known variation within each species and among different species

d.must be dynamic, changing rapidly in response to changes in environment

which of the following is true concerning a somatic cell mutation a.a small fraction of the gametes carry the mutation b.half of the gametes carry the mutation c.all the games carry the mutation d.only a small group of cells within the organism is affected by the mutation e.all cells within the organism are affected by the mutation

d.only a small group of cells within the organism is affected by the mutation

what are the steps of the cell cycle

g1 phase, s phase, g2 phase, m phase

why must the life cycle of sexually reproducing species alternate between haploid and diploid stages

meiosis must occur at some point in the life cycle to prevent a doubling of chromosomes in each generation

in humans, having dimples in the cheeks is a dominant trait. if a child has dimples but only one of her parents does, what are the genotypes of her parents

one parent dd, other either DD or Dd

The nucleotides within DNA are composed of what?

phosphate group, deoxyribose sugar, and nitrogenous base

in producing a strand of dna the nucleotides are bound by what type of bond

phosphodiester

what features of meiosis allows for independent assortment of chromosomes

random alignment of homologous siter chromatids on the meaphase plate

the single factor (monohybrid) crosses performed by mendal support the observation that

the 2 alleles for a given gene are separated from each other in a individuals gametes

what quality of traits, that mendel chose to study, allowed him to establish the basic laws of inheritance

the alleles that he studied were either dominant or recessive

which of the following would occur from a mutation in the gene's promoter region

the rate of transcription may increase or decrease

which of the following statements is correct about the cell cycle a.the cell cycle is a sequence of replication and division that produces a new cell b.the phase of the cell cycle are g1, s and m phase c.in actively dividing cells, the s and g2 phases are collectively known as interphase d.when the s phase of the cell cycle is finsiehd, a cel actually has twice as many chromatids as the number of chromosomes in the g1 phase e.during the g2 phase, the cell grows and copies its chromosomes in preparation for cell division

when the s phase of the cell cycle is finsiehd, a cel actually has twice as many chromatids as the number of chromosomes in the g1 phase

T/F larger genes are usually more likely to incur a mutation than smaller genes

False

T/F offspring receive both of the alleles for a given trait from one parent

False

T/F pea plants cannot self fertilize bc one plant has either ovaries or stamens, but not both

False

T/F somatic cell mutations are heritable

False

what kind of mutation is the result of the addition or deletion of single nucleotides

Frame shift mutation

A ______ is an organized unit of dna sequences that enables a segment of dna to be transcribed into rna and ultimately results in the formation of a functional product

Gene

the processes of transcription and translation are collectivlely known as

Gene expression

In mammalian sex chromosomes, males are____ and females are ____

Hemizygous Homozygous

which of the following types of physical mutagen produces theymine dimer mutations

Ultraviolet light

which of the following is responsible for advancing a cell through the phases of the cell cycle

Cyclins

which of the following are incorrectly matched for a single factor cross a.p generation/true breeding b.f1 generation/monohybrid c.f2 generation/result of f1 cross d.f1 generation/result of p cross e.f2 generation/ result in p cross

F2 generation / result of P cross

This molecule catalyzes bond formation between fragments of DNA

Ligase

sickle cell amemia is a human disease that occurs as a result of what type of mutation in the p-globin gene

Missense mutation

which of the following is a base substitution that changes a single amino acid in polypeptide sequence

Missense mutation

dna associates very tightly with nucleosomes because

Negative charges on DNA are attracted to positive charges of the histone proteins

a researcher determined that a strain of e. coli is producing a shortened version of a protein required for flucose metablism. what type of mutation could be responsible for this shroter than normal protein

Nonsense mutation

______ is to transcription, as ______ is to translation

Rna polymerase Ribosomes

The mechanism of dna replication is

Semi conservative

cells that have doubled many times and have reached a point where they have lost the capacity to divide any further are termed...

Somatic

T/F DNA is a double helix structure whose strands are held together by hydrogen bonds

T

What attaches repetitive dna sequences at the ends of eukaryotic chromosomes

Telomerase

Why is there a need to produce Okazaki fragments on the lagging strand, but no on the leading strand of DNA

The two parental strands of DNA are antiparallel and DNA polymerase makes DNA in the 5' to 3' direction only.

the process that produces mrna from dna is called

Transcription

T/F DNA is a double helix structure whose strands are held together by hydrogen bonds with a to t and c to g base pairing

True

T/F Dna is used as a template to make mrna which contains the things to make polypeptides

True

T/F one major difference between metaphase 1 and metaphase 2 is the presnece or absence of bivalents

True

T/F the termination of translation occurs when a release factor recognizes the stop codon

True