genetics final

All of the following are cytokines except

perforins

In order to identify (or rule out identity) from a DNA sample that is a mixture, the investigator should know

the population groups to which the person of interest belongs or belonged.

Consanguineous marriages are between men and women who are

"blood" relatives

Tay-Sachs disease affects in 1 in 3,600 Ashkenazim births. The value of q2 is

0.0003

The probability of cancer development in the general population is one is _____ people.

1 in 3

Currently in the United States, approximately _____ couples have difficulty in conceiving or giving birth to children.

1 in 6

The type of RNA that carries out RNA interference is

double stranded RNA

If one person in 50 is a carrier of an autosomal recessive disorder in a population, the chance that an unrelated man and woman are both carriers is

1/2500.

The first patent on a living organism was granted in

1873, for Louis Pasteur's use of yeast.

Infertility affects around one in ____ males.

25

In a population in Hardy-Weinberg equilibrium, 75 percent of the individuals have a dominant allele for a particular gene (p=0.75) and 25 percent have a recessive allele (q=0.25). The proportion of homozygous recessive individuals in the F1 generation will be

6.25%.

A man who is paralyzed from a spinal cord injury might become a father using

?

Human leukocyte antigens (HLA) genes account for about _____ percent of the genetic influence on immunity

?

One of the science-related concerns associated with the use of genetically modified (GM) foods is that

?

Most of the effort involved in recombinant DNA technology involves

? creating many copied of specific DNA?

The first mutation typically detected in FAP (familial adenomatous polyposis) colon cancer is

APC mutation

Mutations that enable cancer cells to grow and divide faster than other normal cells are known as _____ mutations.

driver

Which type of white blood cell secretes specific antibodies?

B cell

Preimplantation genetic diagnosis (PGD) screens _____ for genetic disorders.

early embryos

The process in which bacteria with the ability to detoxify certain pollutants are released in a particular area is known as

Bioremediation

Which of these are thought to have anti-cancer benefits?

Cruciferous vegetables

People who cannot become infected with HIV have

Deletions in the genes encoding the CCR5 co-receptor

Transgenic organisms carry the transgene in

Every cell

Which of the following is incorrectly paired?

GIFT; fertilization occurs in a laboratory dish

Identifying combinations of _____ alleles is useful in tissue typing, establishing identity, and estimating disease risk.

HLA

A procedure that places an oocyte and sperm in a culture dish, allows a few cell divisions, and then places the resulting very early embryo in the oocyte donor's uterus is

IVF

In a population in Hardy-Weinberg equilibrium, the frequency of recessive alleles will _____ over time.

remain the same

In an allergic reaction, allergens bind _____, which release allergy mediators.

IgE antibodies on mast cell surfaces

The first drug produced using recombinant DNA technology was

Insulin

_____ places sperm into a woman's reproductive tract to fertilize an oocyte.

Intrauterine insemination

_____ was the first "test tube baby."

Louise Joy Brown

_____ in the human population reduced the incidence and virulence of tuberculosis in the early twentieth century.

Natural selection

_____ uses a blastomere biopsy to obtain a cell to test for genetic and chromosomal abnormalities.

Preimplantation genetic diagnosis

Who invented DNA profiling?

Sir Alec Jeffreys

Cancer does not typically follow a Mendelian pattern of inheritance because it is usually caused by

Specific Combinations of Alleles/ environmental factors

The two major types of lymphocytes are

T and B cells

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

VNTR

VNTRs and STRs differ in that

VNTR repeat is longer than an STR repeat.

The procedure in which fertilization takes place in a laboratory dish and the resulting zygote is placed in the woman's uterine tube is called

ZIFT

The species naturally affected by Leber's congenital amaurosis II that led to development of gene therapy is

a breed of dog.

Which of the following is an assisted reproductive technology?

a couple conceive using sperm from a sperm bank

An ectopic pregnancy results when

a fertilized ovum begins to develop in the uterine tube.

A small group of islanders leave "island A" and travel to "island B." After several generations on island B, a researcher finds that a large percentage of the population is left-handed. Left-handedness is a relatively rare trait on island A. A genetic event that explains this is

a founder effect

A sharp cline may indicate

a geographical obstacle, such as a mountain.

Matthew has the inherited form of the eye cancer retinoblastoma (RB). His disease is caused by

a germinal mutation in one RB allele and a somatic mutation in the other allele.

In an allograft, the tissue donor is

a non-relative

A typhoon devastates a population on "island A" and only a few individuals survive. Several generations later, the replenished population suffers from several inherited disorders that are very rare in other groups. A genetic event that explains this is

a population bottleneck

Surgery is an effective method of treating cancer when

a primary tumor is yet to invade healthy tissue.

Many alleles cause phenylketonuria (PKU). A unique mutation found only in Yemenite Jews is probably

a result of genetic drift.

Combined DNA Index System (CODIS) is

a system for crime laboratories to share DNA profiles.

In gamete intrafallopian transfer (GIFT), fertilization occurs in

a uterine tube.

The functions of antibodies include

activating complement, inactivating pathogens, and clumping pathogens

Which of the following is a vector used to deliver genes in human gene therapy?

adeno-associated virus

Using gene therapy to correct ornithine transcarbamylase deficiency (OTC) would prevent buildup of _____ in the blood.

ammonia

Germline gene therapy would correct a genetic defect in

an affected individual and all of his or her descendants.

Newborn screening using mass spectrometry identifies certain single-gene disorders by detecting

an unusual metabolite or metabolic imbalance.

An antigen is

any molecule that can elicit an immune response

Darwin bred pigeons to have particular traits. Today people breed dogs, cats, horses, and other animals for the same reason. These activities illustrate

artificial selection

A genetic counselor might discuss assisted reproductive technologies with a couple who wish to

avoid one parent's passing on a disease-causing allele to a child.

Mitochondrial DNA (mtDNA) is helpful in obtaining a DNA profile for very degraded genetic material because

cells have many mitochondria, and therefore several copies of mtDNA sequences.

In Wilms' tumor,

cells in a child's kidney divide as frequently as if they were still in a fetus.

The connection between stem cells and cancer is that

cells may become cancerous by expressing "stemness" genes.

Caley, a 30-year-old nurse at Bethson Hospital, is diagnosed with a brain tumor. Caley's doctor presents her with multiple treatment options. Which of the following treatment options is most likely to damage Caley's healthy cells in addition to the cancer cells?

chemotherapy

A woman who is infertile because she lacks ovaries would benefit most from

embryo adoption.

Clines are created when

emigrants remove alleles and immigrants introduce alleles

Inflammation helps to fight infection by

creating an environment in the body that is hostile to pathogens

Helper T cells secrete

cytokines

The term used to describe the fact that cancer cells have lost the specializations of the cells from which they descend is

dedifferentiated.

Balanced polymorphism explains why carriers of cystic fibrosis are relatively resistant to

diarrheal illness

Newborn screening reveals that newborn Jessica has inherited phenylketonuria (PKU). Her parents are distraught at the diagnosis, but a nutritionist explains that Jessica can be treated, right away. The treatment for PKU is

dietary

Cancer cells

divide uncontrollably and are immortal.

Natural selection has fueled the rise in MRSA (methicillin-resistant Staphylococcus aureus) infection by

enabling certain bacterial variants to survive in the presence of many antibiotic drugs

Excess tissue growing in the uterine lining is called

endometriosis

Control of human reproduction to achieve a societal goal is called

eugenics

Sheree is referred to a genetic counselor because a cystic fibrosis (CF) test done as a routine part of her prenatal care indicated that she is a carrier of the most common mutant allele. Sheree is stunned, because no one in her family has the disease. She is 26 years old. The genetic counselor would most likely

explain autosomal recessive inheritance and suggest that Sheree's husband be tested for CF.

Which of the following might a genetic counselor do as part of her job?

explain the inheritance of a specific disorder in a family, evaluate risks for relatives, and advise on genetic testing

A suspect's guilt seems highly likely when a very rare combination of markers is

found in the population the suspect comes from, in the suspect's DNA, and at the crime scene.

When all individuals in a population with a certain illness have the same mutation, which present-day patients inherited from shared ancestors, it is an evidence of

founder effect

All of the genes in a population comprise its

gene pool

A _____ mutation is one that is present in every cell of an individual, including gametes.

germline

A woman who has a baby via embryo adoption is her child's

gestational mother only.

The genes of the human leukocyte antigens (HLA) system encode cell surface

glycoproteins

Severe combined immune deficiencies (SCID) affect both

humoral and cellular immunity

The part of an antigen binding site on an antibody that binds antigen is the

idiotype

A nasal spray for cystic fibrosis patients, which contains adenovirus particles carrying a normal human CFTR gene, is an example of

in vivo gene therapy.

In human populations, Hardy-Weinberg equilibrium is seen

infrequently and in large communities with random mating.

A more recently developed cancer treatment is

inhibiting kinases based on genetic information or inhibiting angiogenisis

Which of the following would provide the longest lasting treatment for Leber's congenital amaurosis II?

injecting adeno-associated virus carrying a wild type version of the RPE65 gene into affected cells of the retina

The difference between innate immunity and adaptive immunity is that

innate immunity is fast and generalized; adaptive immunity is slow and specific

Bacteriophages can be used as vectors in recombinant DNA experiments because they

insert genetic information into Bacteria

To create a transgenic organism, a researcher

introduces foreign DNA

Proteins isolated from bacteria and used in recombinant DNA technology to cut DNA at specific sequences are

restriction enzymes

In normal differentiated somatic cells, telomerase

is not expressed and telomere tips erode with each division.

Hardy-Weinberg equilibrium is possible only if the population is

large, with random mating and no migration, mutation, genetic drift, or natural selection.

Tiny fat bubbles used to deliver genes are

liposomes

A person who is a heterozygote for G6PD deficiency is protected against

malaria

In an endogamous community,

many people marry people from within the community

A cancer's spread is called

metastasis

The difference between microevolution and macroevolution is that

microevolutionary changes are small, and macroevolutionary changes are large.

Gene flow is the

movement of alleles between populations.

Which of these affects allele frequencies the least?

mutation

_____ maintains deleterious alleles in a population.

mutation

The population of HIV variants in a person's body changes during the course of infection due to

natural selection

In a population in Hardy-Weinberg equilibrium, frequency of a dominant allele is

p

The requirements for patenting of an invention involving DNA in the U.S. are that it should be

new, useful, not obvious to an expert in the field

The fact that nearly everyone on the island of Sardinia has the same X chromosome sequence indicates that the population has experienced

nonrandom mating

The prevalence of a Y chromosome with the same sequences as Genghis Khan illustrates

nonrandom mating

Nondirective genetic counseling

offers options but not opinions.

Which of the following contributes to subfertility?

oligospermia

The logic behind polar body biopsy is based on

one of the mendelian ones

Maxwell needs to take an anti-depressant drug. He enrolls in a clinical trial to detect genetic variants and gene expression profiles associated with response to various drugs. This approach to selecting a therapeutic drug is called

pharmacogenomics

Enzyme replacement therapy treats

phenotype

A naturally occurring, small, circle of DNA used as a vector to transmit DNA is a

plasmid

Frequency of an X-linked recessive allele in males equals

q

Sporadic cancers result from

recessive or dominant mutations

A molecule that consists of a piece of DNA from one organism combined with the DNA from a member of another species is called

recombinant DNA

A gatekeeper gene

regulates apoptosis and mitosis.

Adenosine deaminase (ADA) deficiency results in

severe combined immune deficiency

A woman is given RhoGAM to protect future fetuses from hemolytic disease of the fetus and newborn if

she is Rh- and the father is Rh+.

A gene expression microarray has

short pieces of DNA of known sequence attached to a small plastic or glass square

Researchers began using short tandem repeats (STRs) because

shorter DNA molecules were more likely to persist in a violent situation.q

Antibody diversity is a consequence of

shuffling of antibody genes into different combinations during B cell development

Nonheritable gene therapy is performed on _____ cells.

somatic

A patient received bone marrow modified by an adeno-associated virus (AAV) carrying a human gene that encodes an enzyme her body could not make. This is an example of

somatic gene therapy

Morpholinos are

synthetic molecules that consist of 25 DNA bases attached to organic groups.

An example of an autoimmune disorder is

systemic lupus erythematosis

Diagnosis of hereditary hemochromatosis cannot be based on the results of a genetic test alone because

the disease is non penetrant.

One of the most important types of information that a patient can bring to an initial appointment with a genetic counselor is

the family health history, extending to second degree relatives.

Patent law as it pertains to biotechnology has had to change in recent years in response to

the greatly accelerated speed of DNA sequencing.

In the Hardy-Weinberg equation, 2pq refers to

the proportion of heterozygotes in a population.

A test offered on the Web by a direct-to-consumer genetic testing company genotypes a gene for ability to taste bitter substances. This test is not regulated by the Clinical Laboratory Improvement Amendments (CLIA) because

the test provides information, not a diagnosis.

A limitation of transgenesis is that

the transgene can insert anywhere in the genome.

DNA profiling was less useful in identifying remains from the 2004 tsunami than in criminal cases because

the tsunami left few bodies with collectible DNA.

_____, a recombinant clotbusting drug, is used to limit damage to heart muscle by restoring blood flow.

tissue plasminogin activators

The oncogene that causes Burkitt lymphoma results from a

trans-location that moves a proto-oncogene

A multicellular organism that carries DNA from other species is termed

transgenic

A cancer cell is injected into a healthy mouse. The mouse develops tumors. This experiment indicates that cancer is

transplantable

Lisa and Jack Nash obtained compatible stem cells that cured their young daughter Molly's Fanconi anemia by

using umbilical cord stem cells from a younger sibling, who was conceived and selected for this purpose.

A surrogate mother can help couples have a child when the woman does not have a functional

uterus