intro to cell test five

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. What would be the coding strand DNA for the third codon? Be sure to label the ends as described in the parts above.

5GTT3

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. Write the third codon of this message and label the ends of the codon appropriately. For example if the codon was 5'AAA3' you would enter your answer in the following format: 5'AAA3'

5GUU3

The following eukaryotic structural gene contains two introns and three exons. The table below shows four possible mRNA products of this gene. Use the labels to explain what mutation(s) may have resulted in each mRNA. Drag the correct label to each location in the table. Labels may be used once, more than once, or not at all.

1. Exon 1,2,3 Intron 2-Mutation in a splicing signal sequence in intron 2 2. No mRNA produced- mutation in the gene's promoter sequence 3. Exon 1,2,3 Intron 1,2- Mutations in splicing signal sequences in both intro 1 and intron 2 4. Exon 1,2,3- No mutation in any splicing signal sequence

A DNA template strand has the following base sequence. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Answer the following: What is the complementary strand of this template? (label the ends) Input your answer by labeling the end with the prime number followed by a space and the the nucleotide letters suquentially (no spaces) and finally at the end of the base sequence, insert a space followed by the prime number for the end. For example if the answer was as follows use this format: 5' AAAGCATTAGCC 3'

3' AATGTGCACCTGACTCCTGGAGAGGTA 5'

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. What is the anticodon that would match the third codon in the mRNA, shown above. Again be sure to label the ends appropriately and write out the anticodon in the appropriate direction that it would pair with the codon (Hint remember the codon is 5' to 3')

3CAA5

Following is a transcribed and processed eukaryotic mRNA that is in the cytoplasm: 5'GGCUUUAUUAUGCUCGUUCAAUAGUUAUCUAAAAAAAAAA3' Use this mRNA to answer question in all the parts below. What would be the template strand DNA for this third codon? Be sure to label the ends as described in the parts above.

3CAA5

If the template is transcribed by RNA Pol what is the mRNA produced? . A DNA template strand has the following base sequence same as above repeated for convenience. 5' TTACACGTGGACTGAGGACCTCTCCAT 3' Write the mRNA in the same direction that it would be produced by the RNA pol enzyme and label the ends using the same format as in Part A above.

5' AUGGAGAGGUCCUCAGUCCACGUGUAA 3'

There is a mutation in the repressor that results in a molecule known as a super-repressor because it represses the lac operon permanently. Which of these would characterize such a mutant? A) It cannot bind to the inducer. B) It cannot make a functional repressor. C) It makes a repressor that binds CAP. D) It cannot bind to the operator. A) It cannot bind to the inducer.

A) It cannot bind to the inducer.

Suppose that an induced mutation removes most of the 5' end of the 5' UTR of an mRNA. What is most likely to happen? A) Removal of the 5' UTR also removes the 5' cap and the mRNA will quickly degrade. B) The first exon will not be read because I1 will now serve as the UTR. C) The 3' UTR will duplicate and one copy will replace the 5' end. D) Removal of the 5' UTR will have no effect because the exons are still maintained

A) Removal of the 5' UTR also removes the 5' cap and the mRNA will quickly degrade.

Of the three modes of gene regulation shown in Figure 18.1, which is the most efficient in resource use? A) Transcriptional control B) Post-translational control C) Translational control. D) All three are equally efficient.

A) Transcriptional control

Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the repressor gene (lacI), along with its promoter, to a position at some several thousand base pairs away from its normal position, we would expect the _____. A) lac operon will function normally B) lac operon will be expressed continuously C) repressor will no longer bind to the operator D) repressor will no longer bind to the inducer

A) lac operon will function normally

Label the four mutated DNA segments shown below according to the type of point mutation each represents. Use the codon table above to determine how each mutation would affect the amino acid coding for each segment. Drag the labels to their appropriate locations to identify the type of point mutation shown.

A. Silent Mutation B. Nonsense Mutation C. Missense Mutation D. Frameshift Mutation

What amino acid would be attached to the 3' end of the tRNA containing the anticodon for the third codon in the mRNA?

Val

Which amino acid in Part C above is found on the C-terminal end? Use the 3 letter code for the amino acid

Val

When an amino acid is specified by more than one codon, what is usually shared by the set of codons that specify this amino acid? A) their entire base sequence B) the first and second bases C) the third base D) the second base E) the first base

B) the first and second bases

Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the promoter for the lac operon to the region between the beta galactosidase (lacZ) gene and the permease (lacY) gene, which of the following would be likely? A) The three structural genes will be expressed normally. B) The operon will still transcribe the lacZ and lacY genes, but the mRNA will not be translated. C) Beta galactosidase will not be produced. D) RNA polymerase will no longer transcribe permease.

C) Beta galactosidase will not be produced.

Use this information to answer the question(s) below. Suppose an experimenter becomes proficient with a technique that allows her to move DNA sequences within a prokaryotic genome. If she moves the operator to the far end of the operon, past the transacetylase (lacA) gene, which of the following would likely occur when the cell is exposed to lactose? A) The inducer will no longer bind to the repressor. B) The operon will never be transcribed. C) The structural genes will be transcribed continuously. D) The repressor will no longer bind to the operator.

C) The structural genes will be transcribed continuously

Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene? A) a base substitution at the beginning of the gene B) a base substitution at the end of the gene C) a frameshift deletion at the beginning of the gene D) a frameshift deletion at the end of the gene

C) a frameshift deletion at the beginning of the gene

Transcription of structural genes in an inducible operon _____. A) occurs continuously in the cell B) stops when the pathway's product is present C) starts when the pathway's substrate is present D) starts when the pathway's product is present

C) starts when the pathway's substrate is present

The lactose operon is likely to be transcribed when _____. A) there is more glucose in the cell than lactose B) there is glucose but no lactose in the cell C) the cyclic AMP and lactose levels are both high within the cell D) the cAMP level is high and the lactose level is low

C) the cyclic AMP and lactose levels are both high within the cell

Which of the following regulatory elements is not composed of DNA sequences? A) Enhancers B) Activators C) Silencers D) Promoter-proximal elements

B) Activators

Which of the following regulatory DNA sequences might be located thousands of nucleotides away from the transcription start site of a gene? A) Promoter B) Enhancer C) TATA box D) Promoter-proximal element

B) Enhancer

True or false? One possible way to alter chromatin structure such that genes could be transcribed would be to make histone proteins more positively charged. A) True B) False

B) False

True or false? Regulatory and basal transcription factors regulate transcription by binding to the promoter. A) True B) False

B) False

After transcription begins, several steps must be completed before the fully processed mRNA is ready to be used as a template for protein synthesis on the ribosomes. Which three statements correctly describe the processing that takes place before a mature mRNA exits the nucleus? A) A translation stop codon is added at the 3' end of the pre-mRNA. B) Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes. C) A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA. D) Coding sequences called exons are spliced out by ribosomes. E) A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA

B) Noncoding sequences called introns are spliced out by molecular complexes called spliceosomes. C) A cap consisting of a modified guanine nucleotide is added to the 5' end of the pre-mRNA. E) A poly-A tail (50-250 adenine nucleotides) is added to the 3' end of the pre-mRNA

Which of the following terms describes the DNA-protein complexes that look like beads on a string? A) Histones B) Nucleosome C) 30-nanometer fiber D) Chromatin

B) Nucleosome

Of the three modes of gene regulation shown in Figure 18.1, which is the fastest in response time? A) Transcriptional control B) Post-translational control C) Translational control D) All three are equally fast.

B) Post-translational control

Which of the following secondary mutations might restore normal regulation to the lac operon in a lacOc mutant? A) a promoter mutation that prevents it from being recognized by sigma B) a lacI mutation that produces a repressor than can recognize the mutated lacOc DNA sequence C) an RNA polymerase mutation that allows it to bind to the promoter without using sigma D) a lacI mutation that decreases the ability of the repressor to bind the inducer

B) a lacI mutation that produces a repressor than can recognize the mutated lacOc DNA sequence

Which of the following nucleotide triplets best represents a codon? A) a triplet separated spatially from other triplets B) a triplet in the same reading frame as an upstream AUG C) a triplet that has no corresponding amino acid D) a triplet at the opposite end of tRNA from the attachment site of the amino acid E) a sequence in tRNA at the 3' end

B) a triplet in the same reading frame as an upstream AUG

Which of the following events in transcription initiation likely occurs last? A) Regulatory transcription factors bind to enhancers. B) TBP is recruited to the promoter. C) Basal transcription factors form a basal transcription complex. D) RNA polymerase binds to the promoter of the gene.

D) RNA polymerase binds to the promoter of the gene

Altering patterns of gene expression in prokaryotes would most likely serve an organism's survival by _____. A) allowing environmental changes to alter a prokaryote's genome B) allowing each gene to be expressed an equal number of times C) organizing gene expression, so that genes are expressed in a given order D) allowing an organism to adjust to changes in environmental conditions

D) allowing an organism to adjust to changes in environmental conditions

Allosteric regulation occurs when ______. A) the promoter separates from the DNA B) a repressor binds to an operator C) the sigma factor associated with RNA polymerase binds to the promoter D) RNA polymerase cannot initiate transcription at a promoter E) a regulatory molecule binds to a protein to change its shape and activity

E) a regulatory molecule binds to a protein to change its shape and activity

Which of the regulatory sequences above would be bound by transcription factors that would result in the production of uniquely different proteins in liver cell compared to muscle cells?

Enhancer

Drag and pull Identify details of eukaryotic promoter

Enhancer region - Site where specialized TFs bind CAAT Box/ TATA box- Site where general or basal TFs bind front and back of the transcribed region- Areas removed from mature RNA

Using the mRNA in Part B above, Give the polypeptide that this message would produce. Use the three letter codes and separate each with a dash. For example Met-Ser-Try-Phe (no commas or spaces).

Met-Glu-Arg-Ser-Ser-Val-His-Val