MCDB 3135 Final

Attenuation

"The translation product of the initial segment of the transcript of each operon is a peptide rich in the amino acid that the particular operon controls. If the amino acid is in short supply, translation is stalled at the relevant codons of the transcript long enough for the succeeding segment of the transcript to form secondary structures that allow the transcribing RNA polymerase molecule to proceed through a site that otherwise dictates termination of transcription" (Yanofsky, Nature 289(5800), 1981). What process is described here?

Chargaff's Rules

#purines (A+G) = #pyrimidines (C+T) #A=T and # G=C relative ratios between purined and pyrimidines remains consistant between different tissues of an individual

The nucleophile of the first step of spliceosome-mediated pre-mRNA splicing is the:

2′ hydroxyl of the branch point adenosine.

When evaluating protein P with subunits A and B (A is twice the molecular weight of B), a scientist performed cross-linking experiments. After treating a cell extract containing protein P with a cross-linking compound, she analyzed the results by SDS-PAGE. She observed six bands. Before conducting further analysis, what preliminary conclusions about the in vivo configuration of P can be made?

A conclusion cannont be made yet

enhancer

A regulatory region that can be bound by eukaryotic transcription factors thousands of base pairs from the gene itself is called a(n)

Wobble Base Pairing

A single tRNA is used to translate different codons on an mRNA strand. NOT watson-crick base pairing rules Expression of spontaneous single point mutations is suppressed. tRNA 5′ anticodon base G can bind to mRNA 3′ codon base U. Translation requires 61 tRNAs.

A transition mutation could occur in the first, second, or third position of the ninth codon in the sequence GUA GGG UCG AUU GGC GCA GAA AGU UAG UUA GAG. Which one of the following statements regarding a transition mutation in this codon is TRUE?

A transition mutation in the third position would have a null effect.

Most mRNAs have several poly(A) sites. What is the name of the mechanism that enable usage of different poly(A)s

Alternative Polyadenylation

An RNA processing event that frequently leads to different protein products encoded by a single gene is:

Alternative splicing

Here's a pre-mRNA containing introns. 5'UTR--| E1:200bp ||| i1:400bp |||E2:150bp ||| i2:800bp ||| E3:250bp |--3'UTR What's the mechanism by which different mature mRNAs can be made from a same pre-mRNA?

Alternative splicing

alternative splicing

An RNA processing event that frequently leads to different protein products encoded by a single gene is

A sample of DNA is digested with EcoRI, and then treated with a nuclease that degrades only single-stranded DNA. Which of the following represents the resulting structures of the end sequences? A) 5' ---GA- 3' 5' -TC--- 3' 3' ---CT- 5' 3' -AG--- 5' B) 5' ---G- 3' 5' -C--- 3' 3' ---C- 5' 3' -G--- 5' C) 5' ---GAA- 3' 5' -TTC--- 3' 3' ---CTT- 5' 3' -AAG--- 5'

B) 5' ---G- 3' 5' -C--- 3' 3' ---C- 5' 3' -G--- 5'

A sample of DNA is treated with EcoRI. Which of the following represents the structure of each end of the linear DNA fragments produced by the EcoRI restriction digest? A) 5' ---GA- 3' 5' -ATTC--- 3' 3' ---CTTA- 5' 3' -AG--- 5' B) 5' ---G- 3' 5' -AATTC--- 3' 3' ---CTTAA- 5' 3' -G--- 5' C) 5' ---AT- 3' 5' -CGAT--- 3' 3' ---TAGC- 5' 3' -TA--- 5' D) 5' ---GAA- 3' 5' -TTC--- 3' 3' ---CTT- 5' 3' -AAG--- 5'

B) 5'---G-3' 5'-AATTC---3' 3'---CTTAA-5' 3'-G---5'

H1 function

Binding of H1 ENHANCES REPRESSION of transcription by nucleosomes. H1 binding to the nucleosome condenses the DNA 6 to 7 times more than nucleosome formation alone. Binding of H1 promotes higher-order chromosome structure, such as the 30nm filament. H1 does NOT increase RNA synthesis

During transcription of mRNAs in Eukaryotes, a cap is added to the mRNA: The capped mRNA is then attached through the Cap Binding Protein to the ___________ of RNA Pol II

C-Terminal Domain CTD

What is the sequence of the last 3 nucleotides of all mature tRNA molecules?

CCA

Which site on the ribosome is NEVER occupied by a tRNA linked to a nascent polypeptide chain? E Site A Site P Site

E Site

Which of the following is TRUE of eukaryotic replication?

Eukaryotes have two chromosomal replicases, Pol ε for the leading strand and Pol δ for the lagging strand.

T/F DNA-binding domains and regulatory domains of transcriptional activators are interdependent and inseparable.

FALSE

T/F DNA polymerase I carries out lagging strand synthesis.

False

Which one of the following base pairs is a wobble base pair? G-C A-U A-T G-U

G-U

Which of the following tRNAs could be a suppressor tRNA? Leu-tRNALeu with anticodon 5′CAA Leu-tRNALeu with anticodon 5′UAA Leu-tRNALeu with anticodon 5′UUA Tyr-tRNATyr with anticodon 5′GUA Tyr-tRNATyr with anticodon 5′AUA

Leu-tRNALeu with anticodon 5′UUA

A coprecipitation experiment was performed using antibody to MLN51. Which protein(s) are most likely to coprecipitate with MLN51?

MAGOH, Y14, and eIF4AIII.

function of the lacO region of the lac operon?

Mutation of this region leads to constitutive expression of the operon. NOT TRUE: It encodes for the galactoside permease protein. -It contains the promoter for the operon. -It encodes for the Lac repressor protein.

The bacterial nucleoid is composed of approximately 500 topologically constrained loops. What would be the effect of cleaving one of these loops?

Only that loop would relax because each loop is separately constrained by proteins.

what enzyme carries out polyadenylation?

PAP Poly(A) Polymerase

Which experimental results support the hypothesis that the ribosome is a ribozyme?

Peptidyl transferase activity is not inactivated by treating the ribosome with detergent. Peptidyl transferase activity can be inactivated by base changes in the rRNA. There are no proteins observed within 18Å of the peptidyl transferase active site in the crystal structure. FALSE= Ribosomes from thermophilic organisms are more stable than those from Escherichia coli.

Suppose a unicellular organism was discovered in which strict Watson-Crick base pairing (only G with C, and A with U) was required for tRNA base pairing with mRNA. Which one of the following observations about this organism would NOT be consistent with this claim?

Ribosomes in this organism show significantly more structural differences than in other organisms.

Parts of replisome: Beta-Clamp

Ring shaped protein ENHANCES PROCESSITIVITY of DNA polymerase reaction. usually a 2 color ring

Which of the following is TRUE of chaperone mediated nucleosome assembly?

The NAP-1 chaperone assembles two H2A-H2B heterodimers with an H3-H4 tetramer.

The enzyme telomerase is considered a reverse transcriptase, synthesizing DNA on an RNA template. What is the source of the RNA used in the synthesis of telomeres, and where is it located?

The RNA template is telomerase RNA, which is bound tightly to the telomerase reverse transcriptase (TERT) to form the active telomerase holoenzyme.

How does the TREX complex recognize spliced mRNAs for transport?

The TREX component protein Aly recruits the complex to the 5′ cap of mRNA.

Why are dNTPs rather than dNDPs used as precursors for the DNA polymerase reaction?

The reverse reaction is largely eliminated by the use of dNTPs.

In the CRISPR/Cas9 nuclease system, what is the role of the sgRNA?

The sgRNA is required to pair the CRISPR/Cas9 with its intended target site in the DNA and to activate the CRISPR nuclease domains for cleavage.

In the experiments of Shatkin and colleagues, they used two labels, [32P]GTP and [3H]methyl-S-adenosylmethionine. What if the uncapped mRNA sample showed a moderate peak of radioactivity in the ribosome fraction and a large peak in the unbound mRNA fractions?

These results would suggest that the cap optimizes, but is not required, for ribosomal binding.

How are Pol IV and Pol V different from other polymerases?

They lack the 3′-5′ exonuclease activity. They are unable to proofread and are therefore error prone. They are produced in cells when the DNA sustains damage that stalls the replication fork. Their low accuracy enables them to insert an incorrect nucleotide opposite a damaged template base.

A student sets up three reactions containing a DNA template and all components required of RNA synthesis. To tube #1, core histones are added. To tube #2, core histones and H1 are added. To tube #3, core histones, H1, and Sp1 are added. What could you predict with a good degree of certainty?

Tubes #1 and #3 would show more transcription that Tube #2.

The genetic code is degenerate. This statement is supported by the observations that:

UAA, UGA, and UAG are all stop codons.

The 2 codons for glutamate are CAA and CAG. Which one of the followin would be the anticodon of a tRNA that can recognize both codons? GUC CUG GUU UUG

UUG

How would the SOS response in E. coli be affected by a mutation in the lexA gene that prevented autocatalytic cleavage of the LexA protein?

Uncleavable LexA protein would permanently repress the SOS genes and block induction of the SOS response.

How do chromatin remodeling complexes alter transcription?

activate transcription via bromodomain interaction, repress transcription via chromodomain interaction, and remodel nucleosomes while using energy from ATP hydrolysis

Combinatorial control of gene regulation:

allows for more efficient regulation. allows for fewer factors to control more genes. occurs in both bacteria and eukaryotes. is used in the lac operon.

The _____ model for RNA polymerase II transcription termination is analogous to hairpin model of termination in bacteria.

antiterminator

Pol IV and Pol V of E. coli are called "translesion" polymerases because they:

are able to continue DNA synthesis even if DNA is damaged.

Pre-mRNA splice sites are recognized by the spliceosome through:

base pairing with snRNAs.

Genes or gene products that operate in cis are those that must:

be physically linked.

During tracnscription of mRNAs in Eukaryotes, a cap is added to the mRNA: when is it attached, beginning or end of transcription?

beginning

What is required for formation of the open complex of replication initiation?

binding of DnaA to the four 9-mer consensus sequences, which destabilizes the AT-rich repeat sequences

A group has a collection of temperature-sensitive yeast with mutations in the Ran gene. One mutant is unable to transport RNA into the nucleus; however, RNA is transported out of the nucleus. It is most likely that this mutation disrupts:

binding of importin.

How does the cell prevent the ends of chromosomes being mistaken for sites of chromosome breakage?

binding of specialized telomere-binding proteins that prevent recombination

σ38 was shown to make a footprint on the promoter of the osmY gene. How can this result be interpreted?

binding of σ38 protected sequences from digestion by nuclease and will initiate transcription of the osmY gene.

Repressors can reduce the rate of transcription by:

binding to a site in the regulatory region of a gene that prevents RNA polymerase from binding to the promoter.

Poly(A) site choice

can generate multiple protein products from a single gene.

In the experiments of Shatkin and colleagues:

capped RNA labeled with 32P and 3H migrated with the heavier ribosome fraction.

Poly(A) Polymerase PAP

carries out polyadenylation adds a series of As to 3' of mRNA

The function of DNA ligase is to:

catalyze the formation of covalent bonds between adjacent nucleotides.

What structure in the RNA polymerase of bacteria helps keep the transcription bubble open?

cleft or pin structure

The rate of peptide bond formation in a ribosome is enhanced because (of):

close positioning of the 3′ ends of tRNAs in the A and P sites.

On the following DNA sequence: 5'-AGGGTCTG*G*AGGAACTTCCC TC *ATG*TTGGCTAGCATCAATG-3' 3'-TCCCAGAC*C*TCCTTGAAGGGA G *TAC*AACCGATCGTAGTTAC-5' coding strand? template strand? first 6 RNA sequence transcribed?

coding = top strand template = bottom strand RNA = GAGGAA (starts at +1)

What is the sequence of the anticodon of tRNATrp (write in 5' > 3') Trp codon= UGG

codon = 5'-UGG-3' anti = 3'-ACC-3' 5'-CCA-3'

A variant of histone 4 is discovered; it has significant acetylation of the N-terminal tail as well as additional sequences. In the presence of this variant, transcription from chromosome 2 is drastically reduced. It is most likely that this variant:

contributes to chromosome 2 inactivation

Which of the following experimental methods can reveal which proteins are next to each other in an oligomer?

cross-linking

When performing automated DNA sequencing, all four sequencing reactions can be analyzed together in the capillary gel because:

each ddNTP has a different fluorescent tag.

You discover a new transcriptional regulator of a gene in yeast called fuzzy. You find that this regulator binds cooperatively to both DNA regulatory sites and RNA polymerase. For the fuzzy gene, this regulator is:

either a repressor or an activator.

Transport of mRNA from the nucleus to the cytoplasm is coupled to pre-mRNA splicing. What proteins that are bound at the exon-exon borders facilitate transport?

exon junction complex

The mediator complex:

functions as an intermediary between specific transcription factors bound to upstream promoter elements and enhancers and the RNA Pol II initiation complex.

RNAi has revolutionized the study of plants because it allows scientists to:

greatly reduce the expression of any single gene of known sequence.

GFP

green fluorescent protein used to visualize the gene of intrest

A recombinant DNA was to be constructed by inserting the DNA of interest into the LacZ gene of a BAC vector. The vector also contains a chloramphenicol resistance gene, which is not interrupted. While preparing the ligation mixture, the technician added all the reaction components except the insert. Not realizing the omission, he introduced the ligation mixture into the bacterial cells and plated the cells on medium containing chloramphenicol and X-gal. Which of the following results would be expected?

growth of only blue colonies

During transcription of mRNAs in Eukaryotes, a cap is added to the mRNA: what enzyme attaches the cap to the mRNA?

guanylyltransferase

Parts of replisome: Pol III Core

hand shaped protein catalyzes polymerase reaction. usually yellow, it is on the end of the green clamp loader ("arm area"), the 2 part ring (B-clamp) is often adjcent

A merodiploid is a:

haploid organism that contains a second copy of a part of its genome.

An mRNA that encodes a histone is unusual because:

has a stem-loop structure and stem-loop binding protein instead of 3′ poly(A) tail.

Kyrchanova et al. show that, in Drosophila, two copies of gypsy sequences flanking an eye enhancer prevented transcription of a white marker gene normally activated by the enhancer (PLoS Genetics 9(7), 2013). Thus, in this experiment, the gypsy sequences are acting as:

insulators.

In replication fork structure, the strand being synthesized:

into the fork is the leading strand

The noncoding regions of a primary mRNA transcript that interrupt coding regions are known as:

introns

What is TRUE of the three operators of the lac operon?

lac operon TRUE= Two of the three operators are upstream of the transcriptional start site. One of the operators is contained within the lacZ gene. The DNA between the operators bound by the Lac repressor is looped out to sterically hinder RNA polymerase. lac operon FALSE= All three operators are bound simultaneously by the Lac repressor to repress the expression of the operon.

During initiation of replication, DnaC:

loads DnaB helicase onto each strand to form the prepriming complex.

Which of the following diseases has/have been associated with dysfunctional telomere biology?

lung disease, pulmonary fibrosis, and aplastic anemia

CENPA (histone variant) function

maintains kinetochore attachment

When sequencing DNA, the "sequencing depth" describes the:

number of times a specific nucleotide has been sequenced.

The arrangement of amino acid assignments in the genetic code protects the cell against the effects of mutations in that:

often a change in a codon will result in a similar amino acid residue being inserted, thus minimizing the damage.

What is the easiest way to obtain such complex fragments for plasma inserts without making them w restriction or PCR

order synthetic DNA

The "CTD code" that the Pol II C-terminal domain uses to attract different factors during transcription includes altering, within a repeated sequence of seven amino acids, the:

phosphorylation state of its tyrosines and serines and isomerization state of its prolines.

Capping of eukaryotic mRNAs:

plays a critical role in binding an mRNA to the ribosome.

Sucrose density gradients can be used to separate molecules on the basis of density. A cellular extract is layered on top of a sucrose density gradient and centrifuged. Which one of the following will travel the farthest into the sucrose density gradient?

polysome

Histones can be modified by:

post-translationally modified differently in heterochromatin than in euchromatin as well as on the same gene in different cells.

In eukaryotes, mRNAs that are not engaged in translation are sequestered in localized areas of the cytoplasm called_____ bodies.

processing bodies

main role of polyadenylation?

protect mRNA from 3'->5' exonucleases

Parts of replisome: Clamp-Loader

protein complex facilitates placement of other proteins onto DNA NO DIRECT CONTACT W DNA

Eukaryotes, which RNA polymerases transcribe each group of RNAs? protein-coding RNAs ribosomal RNAs (except 5S) transfer RNAs

protein-coding RNAs= RNA Pol II ribosomal RNAs (except 5S) = RNA Pol I transfer RNAs = RNA Pol III

Observing replication of circular plasmid DNAs by electron microscopy showed that:

replication initiates from a single origin, creating a single replication bubble in the plasmid.

palindrome

same forward & backwards ex: 5'-AATCGAGCCGGCTCGATT-3' C-G C G G C A T G C C G T A A T ---5'-->A T--3'--->

Why do we say the genetic code is degenerated?

several codons encode same amino acid

What is the role of the sigma factor in bacteria?

sigma factor interacts with the RNA polymerase (RNP) and helps RNP bind to DNA on a set of promoters

H3.3 (histone variant) function

stabilizes the open state (transcriptionally ACTIVE)

Each replication fork requires both leading and lagging strand synthesis because

the DNA templates are antiparallel and yet the DNA polymerases only work in one direction.

Lagging strand synthesis is necessary at the replication fork because:

the DNA templates are antiparallel and yet the DNA polymerases only work in one direction.

λ-repressor integrase is transcribed from two different promoters in the phage genome, but:

the PL-derived transcript is longer and degraded because it forms a hairpin structure recognized by ribonucleases.

The "charging" or activation of a tRNA molecule includes the covalent attachment of:

the carboxyl group of an amino acid to the tRNA.

Amino-acyl tRNA synthetases catalyze:

the covalent attachment of amino acids to the corresponding tRNA.

the desired recombinant construct has telomeres on both ends.

the desired recombinant construct has telomeres on both ends.

Which element contributes to the strength of a promoter recognized by σ70?

the distance of the consensus sequences from the transcription start site and each other

Helicase

the enzyme that unwinds the DNA helix during replication in E. coli

Signal integration is exemplified by

the lactose and glucose regulation of the lac operon in bacteria

The bacterial lac operon is positively regulated by:

the presence of high levels of glucose.

The main reason that mRNA transcripts are modified at the 5′ and 3′ ends is:

to protect the RNA from nucleolytic degradation.

The DNA-binding protein Sp1 protects against H1-mediated:

transcription repression when H1 is at low levels.

During oocyte development, mRNA is distributed unevenly throughout the unfertilized egg. An advantage of uneven distribution of mRNA is that:

translation of certain proteins is restricted within parts of the cytoplasm, and mRNA is ready to be translated immediately after fertilization.

Karyopherins are a group of proteins that:

transport RNA.

What treatment will extract histones from chromatin, yet leave it intact as naked DNA?

treating chromatin with negatively charged polymers (e.g., heparin and dextran sulfate)

The molecules that activate riboswitches:

turn some riboswitches into enzymes.

Nick translation by DNA polymerase I includes all the following:

- degradation of the RNA primer. - synthesis of DNA - creation of PPi. - use of the template DNA strand does NOT include: ligation of newly synthesized DNA

The genetic code is degenerative because:

1 particular amino acid can be encoded by more than 1 codon

steps of spliceosome-mediated pre-mRNA splicing

1) 2′ hydroxyl of the branch point adenosine. 2) 3′ hydroxyl of the 5′ splice site exon.

How do modified and unmodified histone subunits become distributed among nucleosomes after replication?

1. Both strands of DNA retain H3-H4 modified pairs, and 2. then are repopulated with unmodified H3-H4 pairs, 3. followed by modified and unmodified H2A-H2B.

steps required for the addition of the 3′ poly(A) tail to the transcript

1. Pol II transcribes the poly(A) addition site, TTATTT, which is 5′ to a GC-rich sequence 2. Polyadenylation factors bind to the TTATTT site. 3. 4. 5.

Order of splicing events

1. U1 binds to 5' splice site and U2 binds to the branch point 2. U1 brings the 5' splice site and the "A" of branch point together 3. binding of U4, U5, U6 4. The 2' hydroxyl of the "A" at the branch point serves as a nucleophile at attack the phosphodiester bond at the 5' exon 5. Formation of a lariat on the intron 6. U5 base pairs with exons 1 and 2, maintaining them together 7. 3' hydroxyl of exon 1 serves as nucleophile and attacks phosphodiester bond at 3' splice site 8. release of exon as a lariat

Noller's "fragment reaction" demonstrated that:

1. bacterial 50S ribosomal subunits can carry out peptidyl transfer alone, 2. bacterial 50S subunits lacking any protein component can carry out peptidyl transfer, 3. and bacterial 50S subunit rRNA is largely intact, even without protein present.

steps of bacterial transcription

1. formation of the closed complex 2.formation of the open complex 3. promoter clearance 4.formation of the elongation complex

During transcription of mRNAs in Eukaryotes, a cap is added to the mRNA: Functions of the cap

1. protect from 5'->3' exonucleases 2. promote export to cytoplasm 3. promote translation initation

3 way Chromatin remodeling complexes modulate gene expression (DO NOT MIX W/ HISTONE MODIFYING ENZYMES! )

1. relocate nucleosome 2. remove nucleosome 3. incorporate histone variants

What are the steps in the ChIP-Chip protocol?

1.cross-link nucleosome histones to DNA in chromatin. 2. Treat nucleosome-DNA complexes with DNAase. 3. immunoprecipitate nucleosome-DNA complexes with histone antibody 4. 5.

Due to the degeneracy of the genetic code, a nucleotide change in the third position results in a change in the amino acid about _____% of the time.

25%

In order to visualize P bodies, a researcher should use a fluorescently labeled antibody specific to:

5′ decapping enzymes.

What is the minimum number of ribonucleotides that is required to code for two amino acids during translation?

6

During transcription of mRNAs in Eukaryotes, a cap is added to the mRNA: what is the cap made of?

7-meG 7-methylguanosine

The chemical structure of the 5′ mRNA cap includes _____ covalently linked to the 5′ terminal residue of the mRNA through a _____ linkage.

7-methylguanosine; 5′ to 5′ triphosphate

"The translation product of the initial segment of the transcript of each operon is a peptide rich in the amino acid that the particular operon controls. If the amino acid is in short supply, translation is stalled at the relevant codons of the transcript long enough for the succeeding segment of the transcript to form secondary structures that allow the transcribing RNA polymerase molecule to proceed through a site that otherwise dictates termination of transcription" (Yanofsky, Nature 289(5800), 1981). What process is described here?

ATTENUATION

Why is there an initiator tRNA

Although the initiator tRNA anticodon recognizes a Met codon, it must be able to bind initiation factors to be inserted directly on P site

how do regulatory binding sites function thousands of base pairs away from their promoter sequences?

Architectural proteins loop out the DNA between the regulatory site and the promoter.

One strand of a chromosomal DNA sequence is shown below. An investigator wants to amplify and isolate a DNA fragment defined by the segment shown in red, using the polymerase chain reaction. Design two PCR primers, each 20 nucleotides long, that can be used to amplify this DNA segment. 5'---AATGCCGTCAGCCGATCTGxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGCGTGCGGCG---3' A) Primer A1: GGAGCTCAGTTAGCTACGAC Primer A2: CGCGCACATCAGACGAACCA B) Primer B1: CCTCGAGTCAATCGATGCTG Primer B2: CGCGCACATCAGACGAACCA C) Primer C1: CCTCGAGTCAATCGATGCTG Primer C2: GCGCGTGTAGTCTGCTTGGT D) Primer D1: CGCCGCACGCTACGCGACAT Primer D2: AATGCCGTCAGCCGATCTGC

B) Primer B1: CCTCGAGTCAATCGATGCTG Primer B2: CGCGCACATCAGACGAACCA

elements of the RNA Pol II core promoter:

BRE DPE Inr TATA box NOT an element=UCE

In studying the separate DNA-binding and transcription activation domains of yeast proteins, Mark Ptashne and his colleagues created a fusion protein in which the C-terminal activation sequences of Gal4p were fused to the N-terminal DNA-binding region of an E. coli repressor, LexA. Which of the following approaches would most likely give rise to such a fusion protein? A)Cut the mRNA from each gene, ligate the RNA, and translate the fused RNA. B) Use a protease to cut two proteins, isolate the peptide fragments, and use a disulfide bond to fuse the two appropriate peptides. C) Ligate DNA fragments encoding the two protein domains, making sure the reading frame is the same. D) Interrupt translation in the cells, causing the ribosomes to jump from one transcript to another. D) Use ion exchange chromatography to purify the two protein domains.

C) Ligate DNA fragments encoding the two protein domains, making sure the reading frame is the same.

Which method demonstrated bidirectional synthesis?

Cells were labeled with low-specific-activity [3H]thymidine followed by a pulse of high-specific-activity [3H]thymidine. This experiment revealed a gradient of radioactive density that is heaviest at both forked junctions.

During initial λ infection, lysis is favored over lysogeny when:

Cro binds to OR3, blocking expression of λ repressor.

A student would like to understand the importance of a disulfide bond to three-dimensional integrity of protein X. She decides to remove the disulfide bond by modifying the two cysteines. What would be the simplest and least disruptive change she could make?

Cys to Ser

You are asked to design a short, synthetic double-stranded DNA fragment that would permit ligation between a fragment produced by an EcoRI digest and a fragment produced by a PstI restriction digest. The junction produced needs to contain the recognition sites for both EcoRI and PstI. Which of the following DNA sequences would accomplish this task? A) 5' -AATTGxxxxCTGCA- 3' 3'-CxxxxG- 5' B) 5' -AATTCxxxxGTGCA- 3' 3'-GxxxxC- 5' C) 5' -AATTGxxxxGTGCA- 3' 3'-CxxxxC- 5' D) 5' -AATTCxxxxCTGCA- 3' 3'-GxxxxG- 5'

D) 5'-AATTCxxxxCTGCA- 3' 3'-GxxxxG- 5'

In nucleotide sequences from E. coli, it is most likely that: A) there is only one possible amino acid sequence for each sequence. B) a sequence of 300 nucleotides codes for approximately 333 amino acids. C) degeneracy allows sequences to code for three overlapping functional proteins. D) an open reading frame of 900 nucleotides is a sequence that codes for a protein. E) an initiation codon is at the 3′ end of an open reading frame.

D) an open reading frame of 900 nucleotides is a sequence that codes for a protein.

DNA A DNA B DNA Z

DNA A -right handed -RNA -more BP/turn DNA B (reg DNA) -right handed -DNA -watson-crick BP DNA Z -left handed -NOT freq. DNA/RNA -NOT watson-crick BP

What enzyme requires ATP hydrolysis to carry out its function in E. coli?

DNA Helicase

Chromatin is composed of:

DNA and protein.

A regulatory region that can be bound by eukaryotic transcription factors thousands of base pairs from the gene itself is called a(n):

ENHANCER

Here's a pre-mRNA containing introns. 5'UTR--| E1:200bp ||| i1:400bp |||E2:150bp ||| i2:800bp ||| E3:250bp |--3'UTR How long would be the longest possible protein produced upon processing and translation of this pre-mRNA? ______ amino acids

Exons = 200+150+250 = 600bp/3 = 200 amino acids 200AA - 1 stop codon = 199 Amino Acids

Why do DNA binding proteins typically scan the major groove of double-stranded DNA instead of the minor groove?

Fewer hydrogen bond donor and acceptor atoms of the DNA bases are found in the minor groove than in the major groove

If ONLY 1 tRNA was used to recognize both Histidine codons, what would be the sequence of the anti-codon of tRNAHis (in 5' > 3')? His: CAU His: CAC

GUG Codon = 5'-CAU, CAC-3' Anti = 3'-GUA, GUG-5' =5'-AUG, GUG-3' AUG encodes another amino acid, SO MUST be GUG

How does H1 binding protect a larger fragment of DNA from nuclease?

H1 binds to one strand of the linker DNA as it comes off the nucleosome and binds a second site in the central region of the DNA supercoil, thus protecting more of the linker DNA.

histone variants and their functions

H2AX → DNA repair macroH2A → X chromosome inactivation CENPA → maintains kinetochore attachment H3.3 → stabilizes the open state (transcriptionally active)

Nuclear Localization Signal (NLS)

Inserted in the fragment to be cloned into a plasmid TRANSLOCATES the gene of intrest to the nucleus

Describe how a frameshift mutation can lead to no protein expressed. Mechanism involved?

Mechanism = NON-SENSE mediated mRNA decay Frameshift mutation => PREMATURE STOP codon during splicing, EJCs DEPOSITED at exon junctions. During 1st translation of mRNA the RIBOSOME DISPLACES EJCs. -if EJCs DOWNstream of stop =NOT DISPLACED by ribosome -> ->RECRUIT UPF1+UPF2-> ->recruits decapping enzymes -> -> DEGRADATION of mRNA = NO MORE PROTEIN PRODUCED

While the structure of H2a, H2b, H3, and H4 have conserved sequences in the region of the histone fold, the N-terminal tails appear disordered in the crystal structure. What is the best explanation?

N-terminal tails must be flexible, as they form intermolecular contacts with other nucleosomes.

Which of the following eukaryotic RNA processing events does occur in the nucleus?

Occurs in nucleus: intron splicing RNA editing polyadenylation NOT in nucleus: degradation of mRNA

the trombone model of replication?

Once the Okazaki fragment is complete, the β clamp is ejected.

What is the SECOND step required for the addition of the 3′ poly(A) tail to the transcript?

Polyadenylation factors bind to the TTATTT site.

TPP riboswitch

Proper functioning of the TPP riboswitch is Mg2+ dependent. In the absence of thiamine pyrophosphate, the Shine-Dalgarno sequence is available for binding by a ribosome. ribosome binding site. When TPP levels are low, mRNAs involved in vitamin B1 synthesis are more susceptible to ribonuclease cleavage. FALSE= Binding of the riboswitch effector molecule prevents translation of the mRNA by occupying the ribosome binding site.

Lemire et al. found that some prophages in Salmonella are activated, following DNA damage of the host, by a different mechanism than λ repressor uses. In this case, when RecA is activated in the SOS response, LexA is cleaved, but the prophage repressors are not. Instead, the proteolysis of LexA allows the transcription of bacterial-encoded antirepressor proteins that, once produced, bind prophage repressors, allowing the induction of these prophages (PLoS Genetics 7(6), 2011). Which of the following is the BEST explanation for why this alternative prophage induction evolved?

Proteolysis is irreversible, while binding of an antirepressor is not, so in the former case, if DNA is repaired, the cell cannot recover, but in the latter case, it can.

RNA processing that chemically alters the mRNA sequence is called:

RNA editing.

transcription initiation steps in bacteria: 4. When the RNA chain reaches ~10nt, there is a structural transition: the sigma factor is cleared from the _________________ channel and often falls off RNAP. This step is called ________________________.

RNA reaches ~10nt: - sima factor cleared from RNA EXIT CHANEL - and often falls off RNAP this step is called PROMOTER CLEARENCE

Bacteriophages use the bacterial SOS system to their advantage when:

RecA facilitates cleavage of repressors involved in maintaining the phage in a lysogenic state.

T/F The homeodomain motif of DNA binding is a conserved 60 amino acid sequence.

TRUE

The beads-on-a-string form of DNA condenses into a compact fiber called the 30 nm filament. What is TRUE about its formation?

TRUE: The histone tails of the octamer histones are absolutely required for filament formation. FALSE: The linker histone is essential for formation of the 30 nm filament. The 30 nm filament is also called a tetranucleosome. The zigzag model describes how the nucleosome array adopts a spiral shape when forming the filament. Histone H1 is essential for formation of the 30 nm filament.

degeneracy

The genetic code decreases the likelihood that transition or transversion mutations in protein-coding genes will have no effect on the structure, and thus the function, of proteins

During the creation of a cDNA library, why is the first primer oligo-DT?

The primer anneals to the poly(A) tail located at the 3′ end of the RNA transcripts.

`Which of the following statements about histone structure and binding of DNA is FALSE?

They contain a histone-fold motif composed of three α helices linked by two short loops. The basic histone side chains are necessary to neutralize the negative charge of the DNA's phosphodiester backbone. Binding of DNA by histones occurs mainly between the conserved histone folds and the bases that are exposed in the minor groove of the DNA. Each histone fold dimer forms a V-shaped structure that contains three DNA binding sites.

Upon initial infection by a λ particle, why are low levels of the xis gene transcribed?

Transcription of the xis gene is stalled at an upstream terminator until enough N protein is expressed to assist RNA polymerase past the terminator region.

In whAT way is a ribosomal protein operon (r-protein) different from the lactose (lac) operon?

Translational inhibition of one gene in an r-protein mRNA often is accompanied by translation inhibition of the entire operon; translation inhibition of one gene in the lac mRNA prevents only translation of that gene.

Which of the following is the SECOND step of a ChIP-Chip protocol?

Treat nucleosome-DNA complexes with DNAase.

Each nucleosome contains:

a histone octamer composed of two copies of each of the following proteins: H2A, H2B, H3, and H4.

what is polyadenylation?

addition of a series of As to 3' of mRNA

H1 protein

aid in the repression of transcription

Catabolite repression is a result of the interaction between:

cAMP and CRP.

Consider the following E. coli partial diploid strain grown in the absence of glucose and the presence of lactose: I(^S)O(^C)Z(^+)Y(^—) / I(^+)O(^+)Z(^—)Y(^+). In this strain, β-galactosidase will be synthesized:

constitutively.

nucleosome

core histone octamer 2(H2A)+2(H2B)+2(H3)+2(H4)

Glycosidic bond

covalent bond between PENTOSE sugar and BASE

Which of the following is the FIRST step of a ChIP-Chip protocol?

cross-link nucleosome histones to DNA in chromatin.

What substrate will allow the DNA Pol 1 "hand" to close and complete the synthesis of the phosphate bond and thus add an additional nucleotide to the DNA strand?

dCTP as a matching guanine

What characteristic of the genetic code decreases the likelihood that transition or transversion mutations in protein-coding genes will have no effect on the structure, and thus the function, of proteins?

degeneracy

Scientists were able to convert fibroblasts into neurons by:

deprogramming the fibroblasts to create iPSCs and then adding specific neuronal transcription factors.

In which ways is the rate of ribosomal protein (r-protein) translation balanced with the rate of ribosomal RNA (rRNA) transcription?

differential strength in binding of an r-protein to its own mRNA compared with an appropriate rRNA

Northern blot

experimental protocol that best shows changes in levels of transcription initiation RNA

Which is the first level at which negative regulation functions in eukaryotes?

inaccessibility of promoter regions through formation of nucleosomes

In a typical sequencing reaction, the amount of dNTPs is much greater than of the ddNTPs. Predict the results if equal amounts of both types of nucleotides were used in each reaction. After gel electrophoresis and visualization:

mostly short fragments would be present and only sequences very close to the primer could be read.

Consider the leader region of the trp mRNA. How would transcription of the E. coli trp operon be affected by removing sequence 4?

no attenuation, and thus transcription would proceed at the maximum level

Comparison of bacterial and mitochondrial ribosomes suggests that:

r-proteins are evolving to take over rRNA functions.

The sigma factor rpoE2, identified in S. meliloti, is active only under high-stress conditions (Sauviac et al., Journal of Bacteriology 189(11), 2007). This is consistent with the idea and conclusion that:

sigma factors provide gene transcription specificity for bacterial RNA polymerases; so under high stress, rpoE2 directs S. meliloti RNA polymerase to transcribe genes needed for response to such stress.

Given the following mRNA sequence, which reading frame yields the LONGEST protein, and probably is the reading frame used by the cell′s machinery? 5′AAAUGGUGAGGGUCGUGGGUUAGAGAUGACGUAGAG

starting with neucleotide 3

The diversion of cellular resources away from growth in favor of amino acid biosynthesis is most accurately called the _____ response.

stringent

The advantage of a suppressor tRNA to a cell could be that it:

suppresses erroneous missense mutations. suppresses erroneous stop codons. produces a longer protein and possibly useful enzyme. produces a longer protein and possibly more versatile receptor.

A student wants to insert gene G into pBR322. Using PstI to obtain the insert with gene G, she also cleaves pBR322 with PstI. After ligation of vector and insert, she transforms E. coli. with the recombinant plasmid. What should she add to the nutrient agar to select for colonies containing plasmid?

tetracycline

If, in an in vitro analysis of accommodation, GTPS is used instead of GTP:

the rate of translation decreases and its fidelity increases, demonstrating a trade-off between the two.

The bacterial Shine-Dalgarno mRNA sequence is:

the ribosomal binding site

The Human Genome Project:

was an international collaboration among 20 sequencing centers located in six nations.

A strain of E. coli cells possessing a mutation in the lacZ gene would have _____ when induced with IPTG and grown on medium _____. blue/white colony; X-gal or no Xgal

white colonies; that contains X-gal

Degradation of RNAs:

with premature stop codons is called nonsense-mediated decay.

_____ can be used to determine which eukaryotic polymerase is responsible for transcribing a particular gene.

α-Amanitin

steps in the experiment of Meselson and Stahl?

- Bacteria were grown on 15NH4 until the entire DNA contained heavy nitrogen. - After growth on heavy nitrogen, the bacteria were transferred to normal light medium for one round of replication. - The DNA was isolated from the cells after one round of replication on light medium. NOT a step: DNA molecules were separated by gel electrophoresis and compared to the expected results for each proposed model.

If a DNA fragment is 34,000 bp long, how many DNA fragments will result after incubation with EcoRI, a restriction enzyme that recognizes a six-base palindrome?

8

the process of nick translation;

After Pol I dissociates from the DNA, the remaining nick is sealed by ligase. The RNA removed from the Okazaki fragments is replaced by deoxyribonucleotides. The removal and replacement of the RNA primer occur simultaneously. Nick translation requires the activities of DNA polymerase I. FALSE: The 3′-5′ exonuclease activity removes the RNA of the Okazaki fragments.

How do modified and unmodified histone subunits become distributed among nucleosomes after replication?

Both strands of DNA retain H3-H4 modified pairs and then are repopulated with unmodified H3-H4 pairs followed by modified and unmodifiedH2A-H2B.

If the TEV protease is denatured due to improper handling, what would be the MOST likely result?.

Both target protein and strongly associated proteins would remain bound to the first IgG affinity.

What experimental approach allowed researchers to confirm the existence of Okazaki fragments?

Cells infected with T4 bacteriophage were grown in the presence of radioactive nucleotides. When DNA was analyzed in alkaline CsCl gradients, the presence of short DNA fragments indicated that discontinuous replication had occurred.

Theorize why the processivity number of DNA Pol III would be significantly HIGHER than that of DNA Pol I.

Cellular machinery has evolved to optimize Pol III activity since it is responsible for replicating genomes.

The key logic behind the DNA-footprinting experiments is that:

DNA unbound by protein will be cut by nuclease added by the experimenter, while that bound by protein will not.

Eukaryotic Pol II transcription typically DOES NOT

DOES NOT require more than 50 polypeptides. DOES NOT involve virtually no abortive transcripts. DOES NOT require (like prokaryotic transcription) no posttranslational chemical modifications. DOES NOT require the helicase activity of TBP to initiate transcription.

One way in which DNA polymerase makes errors is by incorporating dNTP tautomers at the polymerase active site. In proofreading these errors:

Disruption of pairing at the primer terminus slows further chain extension, allowing the mispaired base to move into the 3′-5′ exonuclease site for removal. When a misincorporated base shifts back to its normal tautomeric form, the primer terminus becomes unpaired and no longer fits into the polymerase active site for the addition of the next base. Tautomers exist only transiently and rapidly revert to their usual bonding structure. Sometimes incorrect base pairs between tautomeric bases and the template are indistinguishable in shape and size from normal base pairs and fool the polymerase into incorporating the incorrect nucleotide. FALSE=Purine and pyrimidine tautomers can form normal Watson-Crick base pairs with nucleotides in the template strand.

Which of the following contributes to regulation at oriC during replication?

DnaA-ADP, formed when DnaA hydrolyzes its ATP, cannot maintain the destabilization of the origin so the closed complex reforms.

Activation of the IFN-β globin promoter is an example of a histone code. Of the steps given, which is the second in this process? A) The TATA box is exposed in promoter. B) Complexes containing Gcn5 bind to the promoter and acetylate nearby nucleosomes. C) A chromatin remodeling complex such as SW1/SNF binds to and moves the nucleosome. D)Transcription begins. E) A protein kinase binds to the Gcn5 complex and phosphorylates nearby nucleosomes.

E) A protein kinase binds to the Gcn5 complex and phosphorylates nearby nucleosomes.

T/F The Pol III holoenzyme is highly processive because it has two polymerase cores so can replicate twice as much DNA.

FALSE

Why is eukaryotic DNA underwound even though it lacks topoisomerases that can introduce supercoils?

Formation of solenoidal supercoil requires the removal of about one turn from the DNA. These supercoils are introduced by wrapping the DNA around the histone core.

Which of the following proteins involved in the replication of the E. coli chromosome is a topoisomerase?

GYRASE

Consider the following statements about the yeast three-hybrid analysis. I. Protein X is linked to the Gal4p transcription-activation domain. II. Activation of the reporter gene will occur if protein X binds to the same RNA as LexA.

I correct II incorrect

Put the following steps of bacterial transcription in order. I. formation of the elongation complex II. formation of the open complex III. promoter clearance IV. formation of the closed complex

IV. formation of the closed complex II. formation of the open complex III. promoter clearance I. formation of the elongation complex

A student is developing a strategy for cloning a gene into plasmid pBR322. She knows that after creating her recombinant plasmid and transforming it into E. coli, not all cells will have successfully incorporated plasmid. Furthermore, not all incorporated plasmids will contain the inserted gene. She must devise a method for identifying only those cells containing recombinant plasmid. Which of the following schemes would successfully select for bacterial cells containing recombinant pBR322 cloning vector?

Insert the gene into the AmpR gene using PstI. Recombinants will grow on media containing tetracycline but not on media containing ampicillin

experiment showing that replication is bidirectional in mammalian cells

Only the replication bubbles are visible in the autoradiographs because the duration of the experiment was short. This experiment revealed a gradient of radioactive density that is heaviest at both forked junctions. Cells were labeled with low-specific-activity [3H]thymidine. Initial labeling was followed by a pulse of high-specific-activity [3H]thymidine. FALSE = Initial labeling was followed by a chaser of nonradioactive thymidine.

shelterin proteins function

POT1 inhibits telomerase. TRF2 and POT1 prevent cell cycle arrest. Shelterin protects from chromosomal joining by DNA repair enzymes. Shelterin proteins bind both double-stranded and single-stranded DNA.

Kornberg was frustrated with the exonuclease activity that he observed in his DNA polymerase samples. What did he discover?

Pol 1 has both 5′ and 3′ exonuclease activity, performed by two separate catalytic subunits.

Rifampicin

Prevents promoter clearence in bacteria

_____ prevents promoter clearance in bacteria.

Rifampicin

The DNA strand that has the sequence complementary to the transcribed RNA is called the:

TEMPLATE STRAND

Which of the following transcription factors interacts through the minor groove of DNA when binding to the TATA box of RNA Pol II promoters?

TFIID

What is usually involved in the processing of primary mRNA transcripts? addition of multiple adenosines to the 3′ end insertion of intron sequences covalent joining of exons methylation of nucleotides at the 5′ end

TRUE= addition of multiple adenosines to the 3′ end insertion of intron sequences covalent joining of exons methylation of nucleotides at the 5′ end

How did early studies distinguish between proteins required for replication and those specifically for initiation?

Temperature-sensitive genes that play a role in the initiation of replication allowed already initiated DNA synthesis to continue at the nonpermissive temperature until replication of the chromosome was finished.

Mg2+ ions function in the polymerase reaction:

The active site of DNA polymerase contains two Mg2+ ions. The two Mg2+ ions carry out the catalysis with no participation by amino acids. 1st Mg2+ ion deprotonates the 3′OH of the previous nucleotide. 2nd Mg2+ ion facilitates the departure of the pyrophosphate leaving group. FALSE: The active site Mg2+ ions are held in place by two histidine residues.

the structural features of DNA polymerase I?

The enzyme active site shape can only accommodate the shape of a correct base pair.

Which of the following is TRUE of the second experiment carried out by Meselson and Stahl on the 15N-labeled cells to distinguish between semiconservation and dispersive replication?

The expected result for semiconservative replication after two rounds of replication and analysis in a native CsCl gradient is two DNA bands.

How do eukaryotes select origin sequences at which to initiate replication?

The initiator protein, origin recognition complex, binds to the conserved elements of the ARS in G1.

The torpedo model of Pol II transcriptional termination is so-called because:

a 5′ to 3′ exonuclease is proposed to chew the end of the uncapped residual RNA until it reaches Pol II and pushes it, or torpedoes it, off the DNA template.

When comparing the solenoid model versus the zigzag model, the primary difference is that the solenoid model proposes:

a one-start helix, while the zigzag model proposes a two-start helix.

If eukaryotic DNA could only be replicated using a single replication fork, what results would be seen with DNA extracted from cells that were pulsed with low-specific-activity [3H]dTTP followed by high-specific-activity [3H]dTTP?

an autoradiograph showing a long tract of the chromosome with low levels of radioactive density flanked by high levels of radioactive density

Our understanding of tetranucleosomes includes that they: D assume a single, predictable condensed structure in the cells.

are formed when four nucleosomes are bound to a single DNA molecule.

In bacterial RNA polymerase, sigma factors:

bind transiently to the core enzyme and direct it to specific DNA-binding sites.

Analysis of chromatin by the ChIP-Chip protocol has yielded information on the position of nucleosomes located at:

both the 5′ and 3′ ends of transcribed genes of several organisms.

Mutations in the same protein—a protein called AFF4 that is central to the Pol II transcriptional elongation complex—in three unrelated human families is responsible for a newly discovered syndrome. This syndrome affects the heart, stature, cognition, metabolism, lungs, and skeletal system (Izumi et al., Nature Genetics 47(4) 2015). The BEST explanation for the diversity of phenotypes found in this syndrome is that:

efficient Pol II transcriptional elongation is important for synthesis of virtually all mRNAs, so it is not surprising that mutants in elongation would have broad phenotypic effects.

Cancer cells are immortal because immortal cell lines:

have reactivated their telomerase, which allows indefinite replication without loss of chromosome ends.

Which of the following is the third step of a ChIP-Chip protocol?

immunoprecipitate nucleosome-DNA complexes with histone antibody

Regions of the genome in which H1 is bound tend to be transcriptionally relatively inactive because H1 binding:

increases compaction of the DNA. stabilizes nucleosomes. promotes higher-order chromatin structure. prevents access of regulatory proteins to promoters.

In an assay for telomerase activity designed for the sequence GGGTGTTTGGGTGTTTGGGTGTTT, if the telomerase were present, then the ladder would MOST likely show a(n):

ladder of sequences of increasing size, depending on where the primer annealed to the template and how many eight-nucleotide units were synthesized.

With regards to DNA polymerases, the "processivity number" reflects the number of:

nucleotides incorporated before the polymerase disassociates from a template.

While RNA polymerases do not have the proofreading functions of DNA polymerases, this is generally NOT a serious problem because:

so many "good" copies of a transcript are usually made from a given DNA strand.

The term "semidiscontinuous DNA replication" indicates:

the mechanisms of leading- (continuous) and lagging- (discontinuous) strand synthesis.

Based on the results obtained by Meselson and Stahl, after three rounds of replication _____ in the gradient.

the ratio of light and mixed DNA strands would be 3:1

To clone an insert into a bacterial plasmid so that it is oriented in only one direction (versus both), it would be best to:

use a restriction enzyme that forms a sticky end at one end of the vector and insert, and another restriction enzyme that forms a different sticky end at the other end of the vector and insert. Then ligate.

What component of the Pol III holoenzyme is responsible for its ability to polymerize DNA rapidly for long stretches?

β clamp

The clamp loader loads the β sliding clamp onto the DNA. Review the steps listed below. Which step would come THIRD?

γ (gamma)—β clamp—ATP complex binds primed DNA .

Which of the following is INCORRECT regarding a genomic library? A) Introns and exons are represented in the final genomic library. B) The insert DNA is prepared for the ligation via a partial genomic digest. C) The vector DNA is prepared for the ligation via a partial genomic digest. D) The goal is to have a library that represents all the genome of the organism of interest. E) A BAC or YAC vector is well suited for constructing a genomic library.

C is INOCRRECT A) Introns and exons are represented in the final genomic library B) The INSERT DNA is prepared for the ligation via a partial genomic digest. D) The goal is to have a library that represents all the genome of the organism of interest. E) A BAC or YAC vector is well suited for constructing a genomic library.

The N-termini of histone proteins protrude from the core particle of the nucleosome. How do these histone tails affect the regulation of chromatin structure?

protrude between the 2 DNA strands that supercoil around the octamer and interact with the adjacent nucleosomes, ARE the TARGET of CHEMICAL modifications that change the electrical charge, shape, and other properties of the histones.

Bacterial mRNA transcripts do not include a poly(A) tail. Therefore, the process of creating a cDNA library requires:

random primers for the first strand of DNA synthesis.

What are the 3 recognition & attachment sites that ensure the correct location of fMet-tRNAfMet in the P site in the initiation complex?

(1) the codon-anticodon interaction involving the initiation 5′-AUG fixed in the small subunit portion of the P site and (2) interaction between the Shine-Dalgarno sequence in the mRNA and the 16S rRNA of the small subunit. (3) binding interactions between the large-subunit portion of the P site and the fMet-tRNAfMet

The correct location of fMet-tRNAfMet in the P site in the initiation complex is ensured by at least three points of recognition and attachment. Two of the points of recognition and attachment are (1) the codon-anticodon interaction involving the initiation 5′-AUG fixed in the small subunit portion of the P site and (2) interaction between the Shine-Dalgarno sequence in the mRNA and the 16S rRNA of the small subunit. What is the third point of recognition and attachment?

(3) binding interactions between the large-subunit portion of the P site and the fMet-tRNAfMet

transcription initiation steps in bacteria

1. Sigma-bound polymerase binds to the promoter. DNA is double stranded and the sigma factor blocks the active site. -This is the CLOSED complex state. 2. The SIGMA FACTOR moves away from RNAP active site, letting DNA enter the active site. In the active site, the PIN promotes opening of the DNA. -The complex is now in open state. 3. Because RNA polymerization is initiated without a primer, the polymerase needs to hold the first nucleotides residues together to catalyze the phosphodiester bonds. -This is unstable and often leads to several cycles of ABORTIVE INITIATION until RNA chain reaches ~10 nt. 4. When the RNA chain reaches ~10nt, there is a structural transition: the sigma factor is cleared from the RNA EXIT channel and often falls off RNAP. -This step is called PROMOTER CLEARENCE.

Wobble base-pairing accounts for mismatches at _____ positions (as ordered 5′ to 3′) of the codon and anticodon, respectively.

3rd and 1st

The nucleophile of the second step of spliceosome-mediated pre-mRNA splicing is the:

3′ hydroxyl of the 5′ splice site exon.

Due to the degeneracy of the genetic code, how many possible RNA molecules can encode the peptide Met-Trp-Cys-Tyr?

4

During transcription of mRNAs in Eukaryotes, a cap is added to the mRNA: 5' OR 3' end?

5'

transcription initiation steps in bacteria: 3. Because RNA polymerization is initiated without a primer, the polymerase needs to hold the first nucleotides residues together to catalyze the phosphodiester bonds. This is unstable and often leads to several cycles of ________________________ until RNA chain reaches ~10 nt.

ABORTIVE INITIATION

How can repositioning nucleosomes affect transcription

AFFETCS: Moving nucleosomes could EXPOSE a promoter resulting in ACTIVATION of transcription. -Moving nucleosomes could COVER a promoter resulting in repression of transcription. DOES NOT: Transcription is not affected by repositioning of nucleosomes. -Moving nucleosomes could expose a promoter resulting in repression of transcription.

Crick and Brenner's experiments used recombination between mutant genes that had insertion or deletion (indel) mutations to show that there are no gaps in the genetic code. The wild-type sequence of a region of a gene and a deletion mutant of the gene are shown below. Recombination with the sequence _____ would restore the reading frame of the deletion mutant gene. Wild type AUGCGUCGAGUUAUUACGGGG Deletion mutant AUGCGUGAGUUAUUACGGGG

AUGCGUCGAGUUAUUACGGGGG

Which of the following mRNA sequences could encode for the peptide Met-Ala-His-Ser? AUGAAUCACUCU AUGAAUCAUUCA AUGGCUCACAGC UCUCACGCUAUG

AUGGCUCACAGC

The partial sequence of one strand of a double-stranded DNA molecule is: 5´- - -GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG- - - 3´ The cleavage sites for the restriction enzymes EcoRI and PstI are shown below. EcoRI 5' -G*AATTC- 3' CTTAA*G PstI 5' -CTGCA*G- 3' G*ACGTC Write the sequence of both strands of the DNA fragment created. When this DNA is cleaved with both EcoRI and PstI, what double-stranded sequence fragment is produced? A) 5'GAAAGTCCGCGTTATAGGCATG'3 3'CTTTCAGGCGCAATATCCGTAC'5 B) 5'GAAAGTCCGCGTTATAGGCATG'3 3'---ACGTCTTTCAGGCGCAATATC CGTACTTAA---5' C) 5'---TGCAGAAAGTCCGCGTTATAG GCATG ---3' 3'---ACGTCTTTCAGGCGCGAATAT CCGTACTTAA---5' D) 5'---GAAAGTCCGCGTTATAGGCAT GAATT---3' 3'---ACGTCTTTCAGGCGCAATATA CCGTACTTAA---5'

B) 5'GAAAGTCCGCGTTATAGGCATG'3 3'---ACGTCTTTCAGGCGCAATATC CGTACTTAA---5'

Which of the following describes an accurate order of events in translation? A) Initiation of translation occurs only after the small subunit dissociates from the mRNA. B) The first aminoacyl-tRNA molecule binds to the small subunit before the large subunit binds. C) The large subunit of the ribosome binds the mRNA before the small subunit. D) Ribosomal translocation occurs before the first aminoacyl-tRNA molecule binds to the small subunit.

B) The first aminoacyl-tRNA molecule binds to the small subunit before the large subunit binds.

How do modified and unmodified histone subunits become distributed among nucleosomes after replication?

Both strands of DNA retain H3-H4 modified pairs, and then are repopulated with unmodified H3-H4 pairs, followed by modified and unmodified H2A-H2B.

Genes for products that are required at all times and are therefore expressed constitutively are called _____ genes.

HOUSEKEEPING

transcription initiation steps in bacteria: 1. Sigma-bound polymerase binds to the promoter. DNA is double stranded and the sigma factor blocks the active site. This is the ________ complex state.

CLOSED COMPLEX STATE Sigma-bound polymerase binds to the promoter. - DNA is double stranded and the sigma factor blocks the active site.

Which one of the following most likely represents a difference between class I and class II aminoacyl-tRNA synthetases? STRUCTURAL DIFFERENCES

Class I enzymes typically have only tertiary structure; class II enzymes often have quaternary structure.

How do class I aminoacyl-tRNA synthetases differ from class II aminoacyl-tRNA synthetases? ATTACHMENT OF HYDROXYL GROUP

Class I synthetases attach the amino acid to the 2′ hydroxyl group of adenine, class II synthetases attach the amino acid to the 3′ hydroxyl group of adenine.

Which of the following must occur before polyadenylation commences?

Cleavage between the polyadenylation site and a downstream GU-rich sequence must occur.

The T7 phage-encoded small protein Gp2 is a non-DNA-binding transcription factor that interacts with a domain of the E. coli RNA polymerase β′ subunit and inhibits transcriptionally proficient promoter-complex formation (James et al., Molecular Cell 47(5), 2012). Thus, this is a case of repressor action by: A) indirectly altering the structure of the promoter sequence to prevent RNA Pol binding. B) direct competition, between repressor and RNA Pol, for promoter binding. C) allosteric blockage of the closed-to-open initiation complex transition. D) directly altering the structure of RNA Pol so it is unable to bind promoter sequences. E) directly altering the structure of E. coli transcriptional activators, so they no longer activate transcription.

D) directly altering the structure of RNA Pol so it is unable to bind promoter sequences.

How did Howard Dintzis isolate full length α globin chains for his 3H:114C analysis?

He centrifuged the reticulocyte extract and analyzed α chains that had been released from the ribosomes.

H2A.X (histone variant) function

DNA repair

The zinc-finger proteins that bind DNA without combining with the helix-loop-helix motif: A) only bind as a dimers, like most DNA-binding proteins. B) contain zinc that interacts with both the zinc-finger protein and the DNA sequence. C) contain zinc usually coordinated by 5-10 amino acids of the protein. D) are defined by finger domains containing between 50 and 100 amino acids. E) None of the answers are correct

E) NONE OF THE ANSWERS ARE CORRECT

How is the expression of lac genes affected by a mutation that inactivates the binding site for CRP?

Expression of lac genes would be reduced or eliminated under all conditions.

Which one of the following statements is INCORRECT? A) The switch from lysogeny to lysis is called prophage induction. B) λ Repressor binding to operator regions is cooperative. C) Integration of the λ genome into the host genome results in the removal of some of the phage genome. D) N and Q proteins are terminator proteins. E) Transcription from PL leads to expression of the N protein.

FALSE= D) N and Q proteins are terminator proteins. TRUE= A) The switch from lysogeny to lysis is called prophage induction. B) λ Repressor binding to operator regions is cooperative. C) Integration of the λ genome into the host genome results in the removal of some of the phage genome. E) Transcription from PL leads to expression of the N protein.

How does the organization of related genes into operons enable the coordinated production of proteins?

Genes are transcribed together from one promoter as a polycistronic mRNA. They can be regulated by one set of activators and/or repressors and enzymes required for a common pathway can be synthesized together.

Which enzyme unwinds the DNA helix during replication in E. coli?

HELICASE

Howard Dintzis needed to label one specific protein in order to dissect the mechanism of its synthesis. How did he achieve this?

He incubated immature red blood cells with [14C]leucine followed by [3H]leucine.

How does the proofreading carried out by Ile-tRNA synthetase follow the general principle of proofreading by enzymes when binding interactions do not provide sufficient discrimination between two substrates?

Ile-tRNA synthetase utilizes substrate-specific binding in two successive steps: The first results in aminoacylation of tRNA, and the second is the binding of any incorrect aminoacyl tRNA to a separate active site, where it is hydrolyzed.

After translation of new mRNA, exon junction complexes are removed. If a stop codon is found 5′ of an exon junction complex which has not been removed, what might occur?

Nonsense-mediated decay is triggered to degrade the mRNA.

In a bacterial ribosome: describe the role of P, A, E positions (be able to identify them on a diagram)

P site = polypeptide chain site A site = amino acid-tRNA entry site E site = exit site of tRNA

The carboxyl group of each amino acid is activated and a link is established between it and the information in the mRNA that encodes it _____ protein synthesis.

PROIR TO

What is the FIRST step required for the addition of the 3′ poly(A) tail to the transcript?

Pol II transcribes the poly(A) addition site, TTATTT, which is 5′ to a GC-rich sequence

Parts of replisome

Pol III Core Beta-Clamp Clamp Loader Helicase Primase Leading Strand Lagging Strand Okazki Fragment

Polyadenylation of mRNA requires:

REQUIRED: The transcript is cleaved by an endonuclease that associates with the C-terminal domain of Pol II. Pol II extends the transcript beyond the site where the poly(A) tail is added. The site of poly(A) addition is marked by specific sequence elements in the transcript. NOT REQUIRED: Polyadenylate polymerase uses a poly(U) RNA template to synthesize the poly(A) tail.

Which oRNAs use a Ran-dependent pathway for the transport of RNA across the nuclear membrane?

Ran-dependent = rRNA tRNA snRNA Ran-independent= mRNA

Which RNAs use a Ran-independent pathway for the transport of RNA across the nuclear membrane?

Ran-independent= mRNA Ran-dependent = rRNA tRNA snRNA

transcription initiation steps in bacteria: 2. The _________________ moves away from RNAP active site, letting DNA enter the active site. In the active site, the _________ promotes opening of the DNA. The complex is now in open state.

SIGMA FACTOR moves away from RNAP active site, letting DNA enter the active site. In the active site, PIN promotes opening of DNA. - The complex is now in OPEN state.

How are DNA footprinting and electrophoretic mobility shift assay similar or different?

SIMILAR= in that they both detect protein binding to DNA DIFFERENT= in that one detects the specific nucleotides bound and one does not.

T/F A simplified peptidyl transferase reaction involves the addition of methionine to an amino acid mimic and antibiotic, puromycin. If the methionine is radioactive and peptidyl transferase activity is present, you can detect radioactive puromycin.

TRUE

T/F Strong induction of the lac operon requires lactose (to inactivate the Lac repressor) or a lowered concentration of glucose (to trigger an increase in cAMP concentration and increased binding of cAMP to CRP).

TRUE

T/F Unlike the DNA-binding domains of transcription factors, activation domains appear to have little in the way of defined or common structures.

TRUE

eukaryotic translation initiation

TRUE = A special initiator tRNA is utilized for initiation by cytosolic ribosomes. Polypeptides synthesized by mitochondrial ribosomes begin with fMet. All polypeptides synthesized by cytosolic ribosomes begin with a Met residue, not an fMet. FALSE = The 40S ribosomal subunit binds the mRNA before any initiation factors.

What is true of the reactions that methylate the 5′ end of the primary mRNA transcripts?

TRUE: The methyl groups are derived from S-adenosylmethionine. The enzymes that catalyze the reactions are associated with the C-terminal domain of RNA polymerase II. The enzymes that catalyze the reactions are guanylyltransferases. NOT TRUE: The reaction occurs after the entire transcript is synthesized.

What is TRUE about telomeres and immorality?

TRUE: Tumor cell lines can be immortal if their telomerase gene is reactivated. FALSE: Immortal cell lines lack telomeres. - Immortal cell lines lack telomerase. -Reactivation of telomerase in humans will cause them to become immortal. - Immortal cell lines have telomerase activity but cannot form t-loops and don't have protective proteins to prevent recombination repair.

What is usually involved in the processing of primary mRNA transcripts?

TRUE: addition of multiple adenosines to the 3′ end covalent joining of exons methylation of nucleotides at the 5′ end FALSE: insertion of intron sequences

Which of the following is TRUE about the two tRNAs for methionine in bacteria? A)One, Met-tRNAMet, is used exclusively when the 5′-AUG is the initiation codon for protein synthesis and the other when the AUG occurs anywhere else in the growing polypeptide. B) The one used exclusively at the start of translation is formed in two successive reactions prior to arriving at the ribosome. C)The one used exclusively at the start of translation is formed in two successive reactions upon arriving at the ribosome.

TRUE= B) The one used exclusively at the start of translation is formed in two successive reactions prior to arriving at the ribosome. FALSE= A)One, Met-tRNAMet, is used exclusively when the 5′-AUG is the initiation codon for protein synthesis and the other when the AUG occurs anywhere else in the growing polypeptide. C)The one used exclusively at the start of translation is formed in two successive reactions upon arriving at the ribosome.

There are many AUG codons in an mRNAs. Bacteria use a specific mechanism to determine which AUG is the START codon. The __S rRNA of the _________ ribosomal subunit base-pairs with the ____________ sequence located upstream of the start codon.

The 16S rRNA of the SMALL ribosomal subunit base-pairs with the SHINE-DALGARNO sequence located upstream of the start codon.

Five DNA polymerases have been identified in the bacterium E. coli. Two of them—DNA polymerases IV and V—lack a 3´5´ exonuclease activity. What is the function of the 3´5´ exonuclease activity present in many DNA polymerases?

The 3´5´ exonuclease is a proofreading function, eliminating mismatched nucleotides incorrectly inserted into the growing DNA strand.

A researcher engineers a lac operon on a plasmid, but inactivates all parts of the Lac operator (lacO) and the Lac promoter, replacing them with the binding site for the LexA repressor (which acts in the SOS response) and a promoter regulated by LexA. The plasmid is introduced into E. coli cells that have a lac operon with an inactive lacZ gene. Under what conditions will these transformed cells produce β-galactosidase?

The E. coli cells will produce β-galactosidase when they are subjected to high levels of a DNA-damaging agent, such as UV light. Under such conditions, RecA binds to single-stranded chromosomal DNA and catalyzes cleavage of LexA, releasing LexA from its binding site and allowing transcription of downstream genes.

Decreasing levels of tryptophan in an E. coli cell would lead to increasing expression of the trp operon by which one of the following mechanisms?

The Trp repressor protein adopts a conformation in which it is unable to bind to the Trp operator, allowing RNA polymerase to initiate transcription.

Consider the leader region of the trp mRNA. How would transcription of the E. coli trp operon be affected by changing the two Trp codons in the leader peptide gene to His codons?

The attenuation system would respond more to histidine than to tryptophan concentration.

heterochromatin

The chromatin in the nucleus of a eukaryotic cell, which exists in a strongly repressed, highly condensed form, is:

STRINGENT RESPONSE

The diversion of cellular resources away from growth in favor of amino acid biosynthesis is most accurately called the _____ response.

What correctly describes the role of the 1st Mg2+ ion in the polymerase reaction?

The first Mg2+ deprotonates the 3'-OH of the previous nucleotide.

Some human genetic diseases are the result of increases in the number of triplet repeat sequences (e.g., CAG) in the coding regions of genes. Which of the following best explains why the expansion of these repeat sequences is not immediately lethal?

The mutant gene (increased triplet sequences) is targeted by the cell for increased modification of the nucleotides by aminoacyl-tRNA synthase.

A DNA polymerase cannot synthesize a DNA strand de novo from a mixture of deoxynucleotide triphosphates. Explain the role of the primer in the reaction promoted by this enzyme.

The primer is a preexisting strand of RNA or DNA to which new nucleotides are added to the 3´ end.

Which one of the following statements most likely describes the consequence of having reduced function in eIF5 in a eukaryotic cell?

The rate at which the 60S subunit associates with the 40S subunit would be lower.

A DNA polymerase cannot synthesize a DNA strand de novo from a mixture of deoxynucleotide triphosphates. Explain the role of the template in the reaction promoted by this enzyme.

The template is a longer strand that is paired with the primer, which determines the identity of each new nucleotide added via base pairing.

What is responsible for the high processivity of the Pol III holoenzyme?

The β sliding clamp allows Pol III to stay associated with the DNA template as each nucleotide is added.

Shatkin and colleagues used two labels, [32P]GTP and [3H]methyl-S-adenosylmethionine in their experiments. What was their goal?

Transcripts with a cap would be labeled with [3H]methyl-S-adenosylmethionine and [32P]GTP; while transcripts without a cap are only labeled with [32P]GTP

What is a plausible mechanism for allowing different genes in an operon to be expressed at different levels?

Translational regulation by alteration of the ribosome-binding sites for each gene or binding of translational repressors to one or a few of the genes.

Which of the following tRNAs could be a suppressor tRNA? Tyr-tRNATyr with anticodon 5′CUA Tyr-tRNATyr with anticodon 5′GUA Tyr-tRNATyr with anticodon 5′AUA Leu-tRNALeu with anticodon 5′CAA Leu-tRNALeu with anticodon 5′UAA

Tyr-tRNATyr with anticodon 5′CUA

Cite 2 ways one tRNA can base-pair with several codons:

Wobble Pairing INOSINE in wobble position

macroH2A (histone variant) function

X chromosome INCATIVATION

A ribonucleoprotein is:

a noncoding RNA complexed with protein.

An experiment designed to knock out peptide bond formation in a ribosome would most likely include:

a nuclease specific for RNA.

Scientists have determined specific nucleotide positions involved in substrate discrimination by aminoacyl-tRNA synthetases primarily by:

altering particular nucleotides in the tRNAs and seeing which ones affect substrate specificity.

The nucleotide positions in a tRNA that confer aminoacyl synthetase specificity tend to be concentrated in the:

amino acid arm and elsewhere in the anticodon arm, as well as other parts of the tRNA molecule.

The enzyme that catalyzes the activation of tRNA molecules is:

aminoacyl-tRNA synthetase

Global positive regulation of groups of genes can be accomplished through:

an allosteric change in a common repressor causing proteolysis of the repressor. enhanced expression of a common activator. inactivation of a common repressor induced by interaction with a small molecule effector.

Expression in E. coli of a suppressor tRNAtyr with a mutated anticodon, 5′CUA, would most likely result in:

an increase in the number of overly long proteins.

Consider the regulation of lactose metabolism of an E. coli merodiploid with a lacZ mutation in one copy of the operon and a mutation in the promoter sequence of the other copy of the operon. This merodiploid would _____ functional β-galactosidase _____.

be unable to produce; at all This merodiploid would BE UNABLE TO PRODUCE functional β-galactosidase AT ALL.

A student is interested in the localization of MLN51. Actively growing cells are prepared for immunofluorescence. The cells are treated with a monoclonal antibody to MLN51, then washed and treated with a second antibody with a fluorescent tag and specific to the monoclonal antibody. Which part(s) of the cell would most likely show immunofluorescence?

both nucleus and cytoplasm

The eukaryotic protein called Mediator exerts its action by:

bridging regulatory proteins bound to an enhancer and RNA polymerase.

what is a a function or characteristic of initiation factors that is common to both bacteria and eukaryotes?

bring initiator to the P site on the small subunit

Proteins that bind to acetylated lysine residues in the histone tail contain:

bromodomains.

It is consistent with the function of proteasomes that, since their integrity decreases with age, their dysfunction is associated with late-onset neurodegenerative disorders like Alzheimer's (Saez & Vilchez, Current Genomics 15(1), 2014) because, in Alzheimer's, misfolded proteins:

build up in neurons, and if these misfolded proteins cannot be degraded, disease may result.

Parts of replisome: Primase

component of replisome that synthesizes RNA + requires association w HELICASE for activity

The chromatin in the nucleus of a eukaryotic cell, which exists in a strongly repressed, highly condensed form, is:

heterochromatin.

Parts of replisome: helicase

hexameric protein that harnesses energy of NTP hydrolysis to drive DNA strand seperation.

function of termination factors or release factors

hydrolysis of the terminal peptidyl-tRNA bond

If ONLY 1 tRNA was used to recognize all the Isoleucine (Ile) codons, what would the sequence of the anti-codon of tRNAIle (write in 5' > 3')? Ile: AUU, AUC, AUA

iAU codon: AUU AUC AUA anti: UAA UAG UAU INOSINE in the wobble position it the only way to recognize all Ile codons.

Marzluff and his colleagues determined that cleavage and polyadenylation specificity factor CPSF-73 was responsible for histone pre-mRNA processing by:

identifying proteins that were bound to histone pre-mRNA in cross-linking experiments.

The end product measured in Noller's experiments with bacterial 50S subunits was [35S]fMet-puromycin. The nature of this amino acid is:

important because fMet is the initiating amino acid in bacterial protein synthesis, so labeling with it allows for the detection of any polypeptide produced.

In the 1990s, the _____ paved the way to successful whole-genome shotgun sequencing.

improvement in computer hardware and software

A ribosomopathy, or disease associated with the ribosome, marked by seizures and microcephaly is caused by a mutation in RPL10, a protein in close proximity to the peptidyl transferase active site. RPL10 is expressed in all cells but has its predominant phenotypes in those males carrying the mutation (in hemizygous condition on the X) on brain formation (Brooks et al., Genetics 198(2), 2014). A good explanation for this is that:

in cell types other than brain, a protein that can replace the function of RPL10 is expressed. translation of brain proteins is especially sensitive to the amount and the integrity of RPL10. during translational elongation, RPL10 interacts especially closely with particular sequences of amino acids (or mRNA nucleotides) that occur especially frequently in brain-associated molecules so that, without wild-type RPL10, the translation of these proteins is altered detrimentally. wild-type RPL10 is especially important during rapid translation or translation under stressed conditions that might occur uniquely in the developing and dynamic human brain.

Hoagland and associates showed that tRNA was the adaptor molecule using 14C-leucine-tRNAleu in translation. After centrifugation of the translation mix, the presence of 14C-leucine in the pellet indicated the 14C-leucine was:

incorporated into proteins associated or bound with ribosomes.

The amino acids valine and threonine differ only by the presence of a hydroxyl group or a methyl group. The aminoacyl-tRNA synthetases for tRNAVal and tRNAThr must discriminate between using these two very structurally similar amino acids as substrate for creating charged tRNAs. The discrimination by the Valyl-tRNA synthetase is by differential binding of valine and/or threonine to a first site on the synthetase and, then, differential binding to a second site on the synthetase. This is an example of what known process in the specificity of tRNA synthetases?

kinetic proofreading

The MOST likely result of a mutation from the G to an A in the in-frame codon UGA of a collagen mRNA is that:

no change occurs in collagen protein or mRNA.

Which of the following experimental protocols would best show changes in levels of transcription initiation?

northern blot

What is the function of human eEF1b?

regenerate eEF1 using GTP

Alternative Polyadenylation

the mechanism that enable usage of different poly(A)s because most mRNAs have several Poly(A) sites

If a transversion mutation occurred within the first position of the fourth codon in the sequence GUA GGG UCG AUU GGC GCA GAA AGU UAG UUA GAG:

the replacement could result in substitution of one nonpolar residue for another.

When Howard Dintzis treated the 3H-leucine-labeled hemoglobin with carboxypeptidase (an enzyme that removes amino acids from the carboxyl end of peptides), he showed that:

the α chain carboxyl terminal sequences were rich in 3H-leucine, so translation was linear from the N-terminus to the C-terminus.

What experiment tests if a knockdown/out of a gene leads to a change in translation rate

western blot against gene affected vs. variable changed EX: western blot against gene A's protein in control vs. siNudt21

The Ran protein:

when bound to GTP, forms a complex with exportin, and after crossing to the cytoplasm, it hydrolyzes the GTP to release its cargo.

When does an active 80S ribosome form?

when the 43S complex has scanned the bound mRNA and located the AUG start and is then joined by the 60S subunit