micro final exam
which of the following involves type II hypersensitivity in which cells are attacked and destroyed by IgM and IgG antibodies + complement?
ABO blood group incompatibility
what is the primary form of chemical energy produced and used by a cell? Hint- it is produced in catabolic reactions such as gylcolysis
ATP
which of the following causes a "yeast infection"?
Candida albicans
which of the following is a fungus and is most likely to be part of the normal human microbiota?
Candida albicans
which of the following produces an A-B neurotoxin?
Clostridium botulinum
which of the following is a respiratory disease caused by a fungus?
Coccidiodomycosis
which one of the following causes a dangerous systemic fungal infection that starts in the lungs and spreads primarily to the central nervous system?
Cryptococcus neoformans
which of the following is the most frequent cause of recreational waterborne diarrhea?
Cryptosporidium
Which of the following is the correct form of scientific nomenclature used when naming a microorganism?
Staphylococcus aureus (italicized)
which of the following is the proper way to name an organism?
Streptococcus pyrogens (italicized)
which type of cell is activated by the dendritic cell and activates other cells such as B lymphocytes and CTLs?
T helper cell
which type of receptor binds to LPS or flagellin and activates macrophages and dendritic cells?
TLRs
which procedure is used to determine if a chemical is a mutagen and potential carcinogen?
The Ames reverse gene mutation test
which type of hypersensitivity reaction occurs among some people against penicillin?
Type I
which of the following do not cause mutations?
UV radiation, ionizing radiation, nucleoside analogs, and water
which of the following is a characteristic of an enzyme?
a catalyst that lowers the activation energy
people born with a defective immune system due to inheritance of a mutated or missing gene are considered to have what?
a congenital immunodeficiency
what is peptidoglycan?
a disaccharide repeat connected to the same repeats by peptides to form a large, thick complex on gram-positive bacteria and thin layer on gram-negative bacteria
what is a mesophile?
a microbe that grows well at moderate temperatures, around 37 degrees celsius.
some diatoms produce domoic acid, a toxin that causes what?
a neurologic disease
transcription is?
a process in which RNA is generated from a DNA template and forms a structure separate from DNA
which of the following is an example of an exception to Koch's postulates?
a strain of influenza virus causes a respiratory disease in humans but causes neurological problems in rats
which type of immunity has memory and is specific against a particular pathogen
adaptive
which of the following is not an autoimmune disease?
allergic contact dermatitis
grafts between people who are not identical twins are called?
allografts
a chemical that destroys vegetative cells on living tissue is called
an antiseptic
a kind of reserve deposit of certain nutrients stored in the cytoplasm of prokaryotes is called
an inclusion
which of the following is a function of NADH and FADH2?
electron carrier
in the vast majority of cases, the names of enzymes have the following characteristics?
end is -ase like sucrase
which type of toxin remains stable in autoclaving conditions?
endotoxin
a biologist catalyst, it is typically a protein
enzyme
the name for a particular molecule is called ligase. Based on its name, what type of molecule is it?
enzyme
which of the following is effective against endospores?
ethylene oxide
what are the three domains of all life forms?
eukarya, bacteria, archaea
which type of RNA is spliced by enzymes and delivered from the nucleus to the cytoplasm to be translated into protein?
eukaryotic RNA
has flagella composed of microtubules. it moves in a wave-like fashion.
eukaryotic flagella
list three ways that molecules and gases can move across the plasma membrane of a bacterial and/or eukaryotic cell?
facilitated diffusion, active transport and osmosis
the type of bacteria able to grow in both aerobic and anaerobic conditions but grows best in the presence of oxygen is called a
facultative anaerobe
T/F: DNA contains hydrogen bonds between G and T and between A and C that are critical in formation of the double helix
false
T/F: only about 40% of viruses are sensitive to antibiotics?
false
T/F: only bacteria are capable of producing biofilms
false
T/F: temperature is a competitive inhibitor of enzyme activity?
false
T/F: the idea of spontaneous generation, that life forms such as worms and frogs spontaneously generate from a particular environment, explains how life can be observed coming from a microscopic to a macroscopic level.
false
which molecules are needed to generate lipids?
fatty acids and glycerol
which of the following is an example of microbial antagonism?
fecal transplantation curing a C. difficile infection
what is the term used to describe the process in which an end product in a metabolic pathway binds to a site on an enzyme used in the early stages of the pathway and that binding of the end product to the enzyme shuts down the activity of the enzyme?
feedback inhibition
why is agar so useful and valuable in microbiology?
few microbes can degrade it, so it stays solid at body temperature, and it can be sterilized
name a physical method of sterilization for heat-sensitive materials
filtration
which of the following is used to sterilize heat-sensitive material?
filtration
which of the following structures is important in effecting attachment of bacterial cells to various surfaces? Adherence is often an early important step in establishment of an infection
fimbriae
name two structures that are external to the bacterial cell wall?
flagella, pili, capsule, slime layer, or glycocalyx
which category of microorganisms include yeasts and molds?
fungi
which of the following are considered microorganisms?
fungi, viruses, protozoa, archaea, bacteria
if the infectious agent produced ascospores and lived in the soil, it would be a type of what?
fungus
which type of organism produces aflatoxin?
fungus
which of the following are portals of entry?
gastrointestinal tract -skin -genitourinary tract -respiratory tract
which of the following is a key feature found in the cell wall of fungi?
glucans
if glucose and lactose are both in the media that E.coli is growing in, which one will be depleted first?
glucose
starch is broken down into?
glucose
the capsule and the slime layer are examples of a ---------, a general term for substances that surround bacterial cells
glycocalyx
which catabolic pathway is a prelude to both respiration and fermentation?
glycolysis
which of the following generate ATP?
glycolysis, ATP synthase, Kreb's cycle
which of the following generate ATP?
glycolysis, ATP synthase, Kreb's cycle, breakdown of fatty acids into carbon dioxide, fermentation
has a cell wall with a thin peptidoglycan layer between an inner and outer membrane. The outer membrane contains lipid A
gram-negative bacteria
which microbes have lipopolysaccharide (LPS) in their cell walls? LPS is also called endotoxin
gram-negative bacteria
which type of bacteria produces endotxin?
gram-negative bacteria
which type of microbe produces endotoxin?
gram-negative bacteria
has a cell wall with a thick peptidoglycan later and teichoic acid
gram-positive bacteria
which type of bacteria has a thick peptidoglycan layer?
gram-positive bacteria
which is a type of cell that has a plasma membrane, peptidoglycan and teichoic acid?
gram-positive bacterium
which of the following is an example of active transport in bacteria?
group translocation
which of the following is an accurate description of the type of growth found with facultative anaerobes?
growth occurs in both the presence and absence of oxygen, but more growth occurs in the presence of oxygen
which microbes grow well in high salt concentration environments?
halophils
what is another term for parasitic worms?
helminths
which of the following is an oncovirus?
hepatitis B virus
when a high percentage of people in a population are vaccinated against an infectious agent to the point that they are not carriers and will not spread the infectious disease, those in the population that are not yet immunized benefit from not encountering infected individuals. This type of immunity is called
herd immunity
name a protein that is part of the adaptive immune system
histamine
which of the following is a respiratory disease?
histoplasmosis, coccidiodomycosis, blastomycosis
which chemical can be used as a disinfectant, antiseptic, and a sterilant
hydrogen peroxide
which process that occurs in B lymphocytes found in germinal centers results in higher affinity antibodies against a particular pathogen?
hypermutation
give an example of a predisposing factor that would make a person more susceptible to a disease
immunocompromised state
what are antibodies?
immunoglobulin proteins secreted by plasma cells
heavy metals can be effective antimicrobials because they have oligodynamic action. this means they are used
in small amounts
what effect does low-grade fever have on the body?
increases activity of T lymphocytes -slows down activity of bacterial pathogens -speeds up antiviral of interferons
which type of ELISA would be used to test to determine if a person is making antibodies against West Nile virus?
indirect ELISA
name the type of virus that caused a major pandemic in 1918 and 2009
influenza
which type of virus is a segmented RNA virus that can undergo antigenic shift leading to disease in pigs and humans
influenza
name two viruses whose primary mode of action is to attack the respiratory system
influenza, common cold
name 5 zoonotic diseases
influenza, rabies, lyme disease, malaria, plague
which group of cytokines are part of an innate immune system response against viruses infecting cells?
interferons
simple lipids are formed from glycerol and fatty acids. These two sets of molecules come from?
intermediates in glycolysis and Acetyl CoA
which of the following are enzymes or components of bacteria that increase pathogenicity?
invasins -coagulase -M protein -capsules
which of the following methods would be good for sterilizing surgical gloves?
ionizing radiation
IgM
is a pentamer that binds to complement
IgD
is part of the B cell receptor in the primary immune response, but is rarely secreted as an antibody
IgA
is secreted into breast milk
IgG
is the most common class of antibody in the blood
which of the following is most likely to be used to wipe away dirt and microbes on skin just before an injection
isopropanol
why is PCR useful in identifying viruses?
it amplifies part of the nucleic acid of the virus leading to rapid detection and identification of the virus
why is phage conversion medically important?
it can result in a species of bacteria changing into a new strain that can produce toxins that cause more severe disease
how does penicillin disrupt growth of gram-positive bacteria?
it disrupts the active site of an enzyme involved in forming cross-bridges between adjacent peptidoglycan molecules
what is the form or structure of the bacterium Bacillus anthracis that allows it to survive in a wide variety of different environments and still cause disease?
it forms endospores
how does ionizing radiation kill cells?
it ionizes water causing formation by hydroxyl radials that attack and destroy DNA
which of the following statements is an accurate statement about influenza virus?
it is a -strand RNA virus that is easily mutated to form new strains
a pathogenic strain of E. coli designated as O157:H7 can cause major urinary tract infections that can lead to sepsis, the spread of a bacterial infection throughout the body. What does the O stand for?
it is a polysaccharide in the cell wall of E.coli
there are three different components of microbes that are excellent targets of microbial control agents. Name two of them
proteins and plasma membrane
which organism produces oocytes?
protozoa
which type of microbe lives well at lower temperatures?
psychrophile
what is the cell-cell communication system used by bacteria to coordinate their functions as a community?
quorum sensing
which type of RNA is part of ribosomes prior to initiation of translation?
rRNA
which of the following uses parasitism?
rabies virus in neurons
which method of reproduction is used by bacteria?
binary fission
which of the following are methods used to classify microbes?
biochemical tests, morphological characteristics, serology, PCR, differential staining
which of the following is a slime layer produced by bacteria that allow the bacteria to be in a protect3ed environment on rocks or on medical implants?
biofilm
which of the following is involved in inflammation?
blood clotting -neutrophil migration toward injured area -vasodilation -phagocytosis of bacteria -release of cytokines
which of the following is an example of a local infection?
boils
hyaluronidase and collagenase are enzymes secreted by bacterial pathogens that?
break down connective tissue
how do neutrophils and monocytes go from the bloodstream to an inflamed area?
by margination and diapedesis
the process in which DNA is made from the template of a parental strand is called
replication
what is the name of the protein that binds to an operator during regulation of a bacterial operon?
represser
the trp operon is considered a----- operon because tryptophan causes the ----- to bind to the operator
repressible; repressor
in the lac operon,--- binds to the---- shutting down transcription of genes involved in bringing in and breaking down lactose in the cell
repressor; operator
what type of virus is HIV?
retrovirus with two identical strands of RNA
HIV falls into which category of viruses?
retroviruses
which type of virus forms a provirus in the host genome?
retroviruses
name one autoimmune disease
rheumatoid arthritis
which genera of viruses is responsible for causing the majority of common colds?
rhinovirus
which structure, found in both bacteria and eukaryotes, synthesizes proteins?
ribosomes
which of the following is a fungal disease that is characterized by infection of the skin?
ringworm
which of the following contains ribosomes?
rough ER
which of the following are cytopathic effects of viruses?
destructive of host cell chromosomes -release of host cell lysosomal enzymes -formation of inclusion bodies
which of the following is most likely to remove microbes but not be involved in killing them?
detergents
biogenesis refers to the?
development of life forms from preexisting life forms.
media that make is easier to distinguish colonies of a desired organism from other colonies are called
differential media
what properties make endospores resistant to processes that normally kill vegetative cells?
dipicolinic acid in the spore, large number of calcium ions in the spore
which type of ELISA would be used to determine if there are drugs (antigen) in urine?
direct ELISA
----is defined as the destruction of vegetative pathogens on inanimate objects?
disinfectant
which of the following are used to treat HIV infections?
drug combinations that attack reverse transcriptase, integrase and protease
which disease involves a blood fluke that goes through a life cycle in which snails are an intermediate host and humans are the definitive host?
schistsomiasis
what is the name of the term for a form of asexual reproduction found in protozoa in which the nucleus undergoes multiple divisions before the cell divides?
schizogony
---- produces greatly increased numbers of high-affinity antibodies at a faster rate than the ----.
secondary immune response, primary immune response
what is the name of the cross wall that divide hyphae into distinct, unicellular cell-like units?
septa
what is the name of proteins secreted by pathogens that have the ability to bind more strongly to iron than proteins such as ferritin and transferrin?
siderphores
which of the following statement about HIV and AIDS are true?
the highest levels of HIV-infected individuals are in Sub-Saharan Africa -HIV is a retrovirus -HIV evades the immune system by integrating into the cellular genome and being in a latent state
the definition of morbidity is
the incidence of a specific infectious disease
what is dimorphism in fungi?
the ability to form either yeast or mold depending on the environmental conditions
T/F: an allosteric site is a place on an enzyme other than where a substrate binds that when bound to a chemical or metal ion can inhibit or activate an enzyme
true
T/F: antibiotics do not stop viral infections
true
T/F: aseptic technique are procedures used in the laboratory that prevent contamination by unwanted microorganisms
true
T/F: herd immunity is defined as the phenomenon in which most of the population is immune to a particular disease to the point at which there are not enough susceptible people available to start an epidemic
true
T/F: some protozoa can invade host cells, reproduce them, and cause their rupture
true
T/F: tetanus is an example of a noncommunicable disease because it is not spread from one host to another
true
T/F: the number of microbes present has a major impact on the effectiveness of the antimicrobial treatment
true
T/F: there is a vaccine available that is useful against a cancer-causing virus
true
which of the following is an example of a chronic disease?
tuberculosis
which type of hypersensitivity reaction can lead to a severe systematic reaction to penicillin?
type I (anaphylactic)
which type of hypersensitivity reaction can lead to Rh-induced hemolytic disease of the newborn?
type II (cytotoxic)
which type of hypersensitivity reaction occurs among some people that results in damage to the basement membrane and glomerulonephritis?
type III
which type of hypersensitivity reaction is the one in which complexes of antigen and antibody form on basement membranes leading to activation of complement and damage to nearby cells by neutrophils?
type III (immune complex)
which type of hypersensitivity reaction occurs among some people against poison ivy?
type IV
into which category does the hypersensitivity reaction to latex gloves fall?
type IV (delayed cell-mediated)
what is needed for initiation of DNA replication?
unwinding of DNA by DNA helicase -formation of an RNA primer by primase -binding of DNA polymerase to the primer-template junction
which of the following is found in RNA not in DNA?
uracil
which of the following is used to evaluate the effectiveness of a disinfectant?
use-dilution test, disk-diffusion method
which of the following is most likely to be a coenzyme?
vitamin B12 or riboflavin
which molecule is molecular oxygen converted into at the end of the electron transport chain?
water
which of the following can cause mutations?
water -nucleoside analogs -UV radiation
which of the following infects one billion people worldwide and is spread by fecal-oral transmission
whipworm
which type of cell uses receptor-mediated endocytosis?
yeast cell
give one example of a toxoid vaccine
tetanus vaccine
which cells of the immune system get infected with HIV?
-CD4+ T cells -macrophages -dendritic cells
which of the following are examples of zoonoses?
-diseases that occur primarily in wild animals that can be transmitted to humans -diseases that occur primarily in domesticated animals that can be transmitted to humans -diseases that are transmitted by ticks from mice to humans
what is true containing B and T lymphocytes?
-in the primary immune response, the T helper lymphocyte must be activated by the dendritic cell prior to full activation of the relevant B lymphocyte -a single B-cell receptor for one B cell has the same antigen-binding site as all the other B-cell receptors on that one B cell
how does HIV evade the immune system?
-it hides in the cells as a provirus -it mutates at a high rate leading to many different variants in one person -it destroys the CD4+T helper cell population
which of the following ligands will activate macrophages and/or dendritic cells once the ligands bind to receptors on macrophages and/or dendritic cells?
-lipopolysacchride -single-stranded viral RNA - lipoteichoic acid
what is correct concerning antibodies?
-neutralizing antibodies in the secondary immune response are made by B lymphocytes that have undergone class switching and somatic hypermutation of immunoglobulin genes -IgE is generated as part of the immune response against parasitic protozoa.
Normal microbiota can?
-protect us from disease by stopping overgrowth of pathogens -produce some vitamins that help us survive. -infect people when they enter certain new habitats on and/or in the body.
which of the following affect enzymatic activity?
-temperature -substrate concentration -pH -noncompetitive inhibitors -A source of energy -the availability of necessary cofactors
which of the following have an impact on the effectiveness of antimicrobial treatments
-the time of exposure to the chemical of physical treatment -the number of microbes being exposed to the treatment -the environment in which the antimicrobial agent works best -the characteristics of the microbe
what is correct concerning vaccines?
-there are vaccines against polysaccharides found in capsules -oral vaccines are favored over injection-based vaccines against those pathogens that enter through the mucous membranes such as polio and cholera -Alum is a chemical that improves the effectiveness of human vaccines -DNA vaccines have been used to protect animals from viral diseases and are being testing for possible use in humans
which of the following are properties of endospores?
-they are dormant form of bacteria that can survive in extreme conditions of high heat and no water -they are a form of resting cell produced by the genera Clostridium and Bacillus. Some members of these two genera can cause diseases such as botulism and food poisoning -they are made of dipicolinic acid and large numbers of calcium ions as protection of bacterial DNA against damage
what is order of events in animal DNA viral replication?
1. attachment 2. entry 3. uncoating 4. biosynthesis 5. release
the conditions needed for sterilization of most liquid agar-based media are
121 degrees, 15 psi, 15 minutes
1 ml of broth culture was transferred into 99mls of water. 1 ml of this dilution was then transferred into 99.9 mls of water. if 1 ml of the last dilution was transferred into nutrient agar, what was the dilution of the bacteria relative to the original broth culture?
1: 10,000,000
which of the following are types of exotoxins?
A-B toxins -superantigens -genotoxins -membrane-disrupting toxins
which cell produces antibodies?
B lymphocyte
which type of cell undergoes class switching and somatic hypermutation in the germinal center?
B lymphocyte
which of the following is the proper way to name an organism
Bacillus megaterium
name two microbes that are important healthcare-associated infections
C.difficile, staphylococcus aureus
which complement protein is a key intermediary in the complement cascade?
C3b
what is the macromolecule that contains the genetic information of an individual
DNA
which of the following do not participate in the process of translation?
DNA
what is the name of the enzyme that separates the double-stranded DNA molecule into single strands during the process of replication?
DNA helicase
ciprofloxacin inhibits DNA gyrase. what effect will that have on bacterial cells?
DNA replication will stop. The population of cells will not grow
which of the following is an example of an opportunistic infection?
E. coli living in the intestine for years then entering the urinary tract and causing an infection
which of the following are organelles in eukaryotic cells?
ER, mitochondria, lysosome
name a microbial pathogen that is typically handled at BSL-4
Ebola
which of the following is the correct form of scientific nomenclature used when naming a microorganism?
Escherichia coli-italicized
what is the term or phrase for the idea that microorganisms cause disease?
Germ Theory of Disease
which of the following protozoa causes diarrhea and other intestinal problems?
Giardia intestinalis
which of the following does not yet have a vaccine against it?
HIV-AIDS
name an emerging disease?
HIV/AIDS
Pseudomonas has a plasmid containing the mer operon, which includes the gene for mercuric reductase. This enzyme catalyzes the reduction of the mercuric ion Hg 2+ to the uncharged form of mercury, Hg0. Hg2+ is quite toxic to cells; Hg0 is not. What do you suppose is the inducer for this operon?
Hg2+
which type of antibody is in the form of a dimer, crosses the epithelial cell layer into the lumen of the intestine, and binds to antigens in the digestive tract?
IgA
which protein is used to present antigenic peptide to a T cell receptor?
MHC class II molecule
the following sequence is found in a bacterial gene: 5'CCAGGAGGTCGTTCACATGGACCCTAATTAGCA3' assume all of this sequence is transcribed into mRNA and that translation starts somewhere in this sequence, what is the amino acid sequence of the polypeptide?
Met-Asp-Pro-Asn-stop
Which of the following is categorized as bioremediation?
Microorganisms used by humans to convert toxins, pollutants and wastes from industrial processes into less harmful substances
which of the following statements about the electron transport chain are correct?
NADH transfers electrons to the electron transport chain
which of the following are carriers of electrons to the electron transport chain?
NADH, FADH2
---- are produced by some bacteria, are found in bacteria, and have two functions, providing movement and involved in transferring DNA from one cell to another. These functions are important because they are involved in helping the bacteria cause disease
Pili
which of the following causes malaria?
Plasmodium
T/F: some forms of RNA do not code for proteins
True
the building of complex organic molecules from simpler ones. This involves consumption of energy and dehydration reactions
anabolism
which type of epidemiology uses the case control method?
analytical epidemiology
which of the following is the name of the chemicals produced naturally by bacteria and fungi that act against other microorganisms?
antibiotics
--- is when antibodies bind to parasitic protozoa or helminths, and eosinophils, NK cells, and/or macrophages bind to the antibodies and secrete substances that kill the target cells
antibody-dependent cell-mediated cytotoxicity
to what do antibodies bind in a typical immune response?
antigen on the surface of a potential pathogen
an enzyme may consist of a protein component called an----- and a nonprotein component called a-----?
apoenzyme; cofactor
which domain includes prokaryotes that do not have peptidoglycan in their cell walls?
archaea
injecting a person with antibodies from a horse to fight toxins from a snake bite is a form of
artificially acquired passive immunity
which chronic disease is caused by a roundworm that infects the intestine of over 1 billion people in the world?
ascariasis
which step in viral replication involves the binding of viral proteins to receptor sites, usually proteins, on the surface of the cell?
attachment
sometimes called endoflagella, they are anchored at one end of the bacterial cell and cause the cell to move by a spiral motion
axial filaments
lysogenic conversion in ---- can result in expression of an exotoxin in the prophage
bacteria
which domain includes pathogenic prokaryotes along with prokaryotes found in soil and water?
bacteria
which of the following cause septic shock?
bacteria
in----, transcription and translation are coupled, while in---- they are separated into the nucleus and cytoplasm, respectively
bacteria, eukaryotes
has flagella partially composed of the protein flagellin. They move in a propeller-like fashion
bacterial flagella
name two cells that are part of the innate immune system?
basophils and eosinophils
why does an RNA virus need to make its own RNA polymerase?
because host cells do not make RNA polymerases that can make a copy of the viral RNA genome
what is the name of the protein coat that protects the genome of a virus?
capsid
the breakdown of complex molecules into simpler ones. This involves hydrolytic reactions and the release of energy
catabolism
what is the term used to describe enzyme-regulated reactions that release energy due to the breakdown of complex organic compounds into simpler compounds?
catabolism
which of the following are the three factors, that when combined, result in healthcare-associated infections?
chain of transmission, immunocompromised host, microorganisms in the healthcare-associated environment
list two chemicals that are used to sterilize
chloride, ethanol
what are the major pathways of complement activation?
classical, alternative, lectin
what is the term given to spherically-shaped bacteria?
coccus
----are groups of three nucleotides found in a particular order in an mRNA molecule that determine the sequence of amino acids in a protein
codons
a cofactor that is an organic molecule
coenzyme
which of the following is not involved in helping the bacteria attach to the host?
collagenases
which of the following is a type of asexual spore?
conidium
the Haemophilus influenzae type b vaccine consists of polysaccharide from this gram-negative bacterium connected to protein such as tetanus toxoid. This type of vaccine is called a what?
conjugated vaccine
which of the following are types of vaccines?
conjugated, inactivated virus, DNA, attenuated virus, toxoids
which type of gene is expressed all the time?
constitutive
microbes that grow and multiply in or on a culture medium are referred to as a?
culture
what are the major outcomes from complement activation?
cytolysis, inflammation, opsonization
which type of cell in the adaptive immune response is activated by T helper cells and kills virus-infected cells using perforin and granzymes?
cytotoxic T lymphocytes (CTLs)
---- is the time, in minutes, in which 90% of a population of bacteria at a given temperature will be killed
decimal reduction time
which of the following are parts of the innate immune system?
defensins, lysozyme, C3 complement, stomach acid, interferon pathway
which cell initiates the primary adaptive immune response by internalizing and processing potential pathogens, migrating to the nearest draining lymph node and presenting antigenic peptide on an MHC class II molecule?
dendritic cell
Pseudomonas has a plasmid containing the mer operon, which includes the gene for mercuric reductase. This enzyme catalyzes the reduction of the mercuric ion Hg 2+ to the uncharged form of mercury, Hg0. Hg2+ is quite toxic to cells; Hg0 is not. The protein encoded by one of the mer genes binds Hg2+ in the periplasm and brings it into the cell Why would a cell bring in a toxin?
it is beneficial to the cell to change Hg2+ into Hg0 because then the cell is getting rid of the toxin by changing in into the nontoxic form. Mercuric reductase is in the cell, so Hg2+ needs to be brought into the cell for the reaction to occur
what is MRSA?
it stands for methicillin-resistant Staphylococcus aureus. It is antibiotic-resistant form of a major disease-causing gram-positive bacterium
what are three of the primary end products produced during fermentation?
lactic acid, ethanol, CO2
name the phase of growth during which there is little or no change in the number of bacterial cells, but metabolic activity is high
lag phase
when are capsomeres made during the replication of viruses?
late, during synthesis of the viral proteins
what is the name of the membrane-disrupting toxins that attack phagocytes?
leukocidins
which of the following are characteristics of endotoxin but not exotoxin?
lipid portion of lipopolysaccharide, produces a fever, difficult to make toxoids against it, associated with gram-negative infections
list two ways in which animal viruses are grown in the laboratory
live animals, embryonated eggs
which types of human cells are invaded by the malarie-causing protozoan during its life cycle?
liver and red blood cells
which part of the bacterial growth curve portrays an exponential increase in the bacterial population?
log phase
which of the following is a physical method of microbial control that does not result in sterilization in any circumstance
low temperatures, desiccation
which of the following is a protein that is secreted into tears and saliva and that attacks the cell wall of gram-positive bacteria?
lysozyme
what are the two possible cycles a bacteriophage enters into once if infects a cell?
lytic and lysogenic
which of the following participate in the process of translation
mRNA, ribosome, tRNA, rRNA
name a type of cell that is a phagocyte
macrophage
in which of the following do merozoites infect red blood cells?
malaria
the mosquito is a vector for which of the following diseases?
malaria
which type of cell contains granules of histamine, binds to IgE, is under the skin and mucous membranes, and is involved in allergic reactions?
mast cells
name two vaccines against a specific disease or pathogen
meningitis vaccine, diptheria vaccine
the phenomenon of normal microbiota benefiting the host by outcompeting harmful microbes in an environment is called
microbial antagonism
which class of drugs is derived from genetically modified mice, B lymphocytes and myelomas?
monoclonal antibodies
which type of cell is the precursor to macrophages?
monocyte
where does the energy come from that is used to pump protons (H+) against a concentration gradient across the plasma membrane in bacteria during the production of ATP as part of oxidative phosphorylation?
movement of electrons down the electron transport chain
list three components of the innate immune system that are not cells. These three could be produced and secreted by cells, but do not list any cells
mucus, sebum, earwax
has a cell wall containing mycolic acid
mycobacterium
which of the following is the study of fungi?
mycology
which is a type of toxin by fungi?
mycotoxin
which of the following is used to create monoclonal antibodies
myeloma cells
name the white blood cell found in greater numbers in the bloodstream that any other leukocyte whose primary function is to phagocytize and kill bacteria
neutrophil
list three reasons why emerging infectious diseases are increasing in prevalence?
new forms, people never received vaccines, and there might not be vaccines so people are still getting infected
------ protect us from disease by stopping overgrowth of pathogens
normal microbiota
microbes that establish more or less permanent residence but do not produce disease under normal conditions for the body are called
normal microbiota
which component of the innate system counters potential pathogens found in the digestive tract such as C. difficile, Candida albicans, and Salmonella?
normal microbiota
which of the following is a major difference between bacterial and eukaryotic RNA?
one is spliced, the other is not spliced
what is the process in which electrons are transferred from organic compounds to electron carriers and finally to oxygen or other oxidized inorganic or organic molecules. This results in the release of energy, some of which is converted into ATP from ADP.
oxidative phosphorylation
during which part of cellular respiration is the most ATP produced?
oxidative phosphorylation in the electron transport chain
list three chemical elements that are necessary for microbes to grow and survive
oxygen, carbon, phosphorus
which of the following are factors that influence enzymatic activity?
pH, temperature, substrate concentration
--- is the ability to cause disease by overcoming host defenses
pathogenicity
what is the name of the macromolecular network found in the bacterial cell wall that contains a disaccharide repeat connected by polypeptides?
peptidoglycan
which of the following may be in bacterial inclusions?
phosphate
which of the following are processes or structures that are found only in eukaryotes?
pinocytosis, phagocytosis, smooth ER
which helminth spends its entire life in the human and is detected using a tape-based method to find eggs around the anus?
pinworm
where in bacteria is the electron transport chain located?
plasma membrane
which of the following are targets for killing microbes?
plasma membrane
what is the name of the extra-chromosomal material that can contain genes encoding pilus proteins, antibiotic resistance proteins, and virulence factors?
plasmid
what is the name of the small, circular, double stranded DNA molecule often found in bacteria?
plasmid
self-replicating, gene-containing circular pieces of DNA about 1-5% the size of bacterial chromosomes that may carry genes from sex pili are called?
plasmids
the following sequence is found in a bacterial gene is the same as above, except there is a mutation in the sequence 5'CCAGGAGGTCGTTCACATGGAGCCTAATTAGCCCA3' assume this is not the template stand. assuming all of this sequence is transcribed into mRNA and that translation starts somewhere in this sequence. What type of mutation is it? how will it change the amino acid sequence?
point mutation; no change in the amino acid sequence
which technique is used to find newly mutated bacteria that can survive in the presence of an antibiotic?
postive selection
name a method for obtaining pure bacterial cultures
pour plate method
what is the name of the infectious agent that is spread from an infectious protein not from an organism that has nucleic acid?
prion
the substance produced after enzymatic activity has been completed
product
which of the following is not involved in inflammation?
production of antibodies
what part of the DNA does the RNA polymerase bind to initiate transcription?
promoter
which of the following are regulatory DNA sequences?
promoter, operator
give one reason why bacterial-produced biofilms are important in human health
protect bacteria from antibiotics
which of the following are found in all viruses?
protein, nucleic acid
which of the following chemicals, usually effective in very small quantities, have been used for centuries to kill bacteria?
silver and copper
in the Ames test, suspected mutagen is added to a liquid containing histidine-dependent Salmonella and rat liver extract and compared to a control without the mutagen. Why is the liver extract added?
since the liver is used to detoxify many chemicals, the extract is added to test whether enzymes in the liver will change the chemical into a mutagenic form that might end up in the body
which type of virus needs to make its viral RNA polymerase before entering the next cell?
single-stranded - strand RNA virus
which of the following would be the least effective in disinfecting medical instruments?
soap
when performing a standard plate count, why are the counts reported as colony forming units rather than cells?
sometimes cells are arranged as groups (chains, clusters, etc) rather than as individual cells. Therefore, you do not know if the colony started out as one cell or a group of cells
what instrument is used to measure turbidity of bacteria?
spectrophotometer
which of the following us a disease that occurs occasionally?
sporadic disease
which of the following methods is used to determine the number of bacteria in a sample?
standard plate count, most probable number, microscopic counts, optical density
which of the following is a method for isolating pure cultures?
streak plate
a specific substance that is acted on by an enzyme
substrate
which type of cell is activated by the dendritic cell and produces cytokines that control multiple parts of the adaptive immune response?
t helper cell
which type of RNA binds to amino acids and carries them to the ribosomes during translation?
tRNA
what is phylogeny?
the study of the evolutionary history of organisms
what is microbial ecology?
the study of the relationship of microbes and their environment
generation time is defined as?
the time required for a cell to divide
why are bacteria in the genus Bacillus often resistant to disinfectants?
they form endospores that are resistant to disinfectants
some pathogenic bacteria break down structural proteins under and in the skin causing disease. How can they do this?
they secrete proteases that attack the peptide bonds in proteins in nearby tissues
which of the following are the 4 bases found in DNA?
thymine, adenine, cytosine, guanine
what is the purpose of the disk-diffusion method?
to evaluate the effectiveness of a disinfectant
after the dendritic cell is activated, where does it migrate?
to the nearest draining lymph node
which of the following parasitic protozoan infections involves cats as the definitive host?
toxoplasmosis
the process in which RNA is made from the template of DNA strand is called
transcription
which horizontal gene transfer method involves transfer of genetic information from a dead host to another cell by a bacteriophage?
transduction
----is the process in which "naked" DNA is transferred from one bacterium to another bacterium without the use of bacteriophage or sperical structures
transformation
give one example of genetic recombination that involves horizontal gene transfer
transformation
the process in which protein is synthesized from the sequence of mRNA is called
translation
what is the name of the segments of DNA, sometimes called "jumping genes", that are capable of cutting themselves out of DNA and moving to a different region of DNA?
transposons
which of the following can contain antibiotic resistance genes?
transposons, DNA released from dead cells, plasmids
what is the name of the feeding and growing stage of a protozoan?
trophozoite
T/F: DNA polymerase has a proofreading function that allows it to remove a nucleotide at the end of the newly synthesized strand when the base in that nucleotide does not bind properly to its complement on the template strand
true
T/F: Genomics is the study of all of an organism's genes.
true
T/F: ID50 refers to the amount of a microbe (dose) needed to infect 50% of a population
true
