Warm-up feb 24

In the diagram below, strands I and II represent the two complimentary strands of a portion of a DNA double helix. The sequence of strand I is indicated below. What is the sequence of strand II? Strand I ---------- C - T - A - C ---------- Strand II ---------- ? - ? - ? - ? -----------

GATG

What property of DNA causes it to migrate to the positive pole of the electrophoresis apparatus?

The negative charge of the DNA

What evidence found at the crime scene would contain DNA?

blood

The smaller the DNA fragment, the:

further it moves down the gel

Gel electrophoresis is used to separate the fragments of DNA. The larger pieces of DNA will travel ______________ the smaller fragments through the gel.

slower than

What characteristic separates DNA fragments during gel electrophoresis?

the length of the DNA fragment

The restriction enzyme Haelll cuts between the base pairs GG/CC. ATTGCCATTGGAATACCGTCGAGGCCACCGATTCAGACCAGTGGCC TAACGGTAACCTTATGGCAGCTCCGGTGGCTAAGTCTGGTCACCGG Determine the number of RFLPs in the above DNA sequence.

3

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?

38%

Which of these is correct according to Chargaff's base pairing rule?

A=G

Given the DNA strand GAATTCCTCGAG, what would be the complimentary strand to make the double stranded DNA?

CTTAAGGAGCTC

Scientists are able to produce millions of copies of a specific DNA sequence from a small amount of DNA through the process of:

polymerase chain reaction

When running a gel electrophoresis, DNA will migrate towards the ________ end because DNA has a __________________ charge.

positive, negative