Quiz 18 Questions
In prokaryotes, transcription and translation can happen simultaneously. This never happens in eukaryotes. Why? A) Because transcription takes place in the nucleus in eukaryotes B) Because prokaryotes do not process their RNA after transcription, they are unable to translate it as efficiently as eukaryotes C) Because translation occurs in the nucleus in eukaryotes D) Because eukaryotes get processed with a 5' methyl Guanosine that prevents translation from initiating too soon after the RNA is made E) Because transcription takes place in the cytoplasm in eukaryotes
A
A bacterial RNA polymerase is using the top strand of DNA as a template to synthesize the growing RNA strand shown below the DNA template. Another nucleotide is about to be added. Where does the energy come from to make the next phosphodiester bond? DNA--5' CGGAATTCCGGGGGTGCCTTAAG 3' UAAGGCCCCCACGG A) GTP B) UTP C) NADH D) ATP E) CTP
B
If a tRNA has the anticodon 5' CAG 3', what amino acid will be attached to it? A) Arg B) Leu C) Val D) Gln E) Asp
B
In the following mRNA molecule the codons are read in translation beginning with the START codon. What would be the order of amino acids present in the polypeptide produced by this mRNA? mRNA: 5' UCUGAUGGGCUUGUAC 3' A) serine, aspartic acid, glycine, leucine, valine B) methionine, glycine, leucine, tyrosine C) methionine, phenylalanine, glycine, stop D) methionine, valine, glycine, phenylalanine E) methionine, valine, arginine, valine, valine
B
Which of the following is FALSE regarding translation? A) The ribosome reads the mRNA in the 5' to 3' direction B) Prokaryotes synthesize some proteins on the endoplasmic reticulum that surrounds the nucleus C) Amino acids are attached to the 3' end of the tRNA molecule by an enzyme D) The formation of peptide bonds between amino acids is a condensation reaction E) A stop codon positioned at the A site of the ribosome causes a release factor to bind to the ribosome
B
Which of the following is NOT true of a codon? A) It never codes for more than one amino acid B) It is attached to the 3' end of the tRNA. C) It may code for the same amino acid as another codon D) It consists of three nucleotides E) It is part of the mRNA
B
Which of the following is a true statement? A) There is one tRNA synthetase gene in prokaryotes B) The last base of the codon is at the 3' end C) The tRNA with an anticodon complimentary to the UAG stop codon is called the terminator tRNA. D) Translation stops when the terminator tRNA enters the P site and causes the polypeptide chain to be released. E) Each codon can specify more than one amino acid
B
Which amino acid would be attached to a tRNA molecule with a 3'CUG 5' anticodon? A) Arg B) Glu C) Asp D) Leu E) Val
C
Which of the following correctly lists the components necessary for transcription: A) RNA polymerase, transcription factors, RNA template and DNA nucleotides B) Ribosomes, transcription factors, DNA template and RNA nucleotides C) RNA polymerase, transcription factors, DNA template and RNA nucleotides D) Ribosomes, 5' cap, RNA template and DNA nucleotides E) Primase, transcription factors, DNA template and DNA nucleotides
C
Which of the following is not synthesized from, or does not use DNA as a template? A) Ribosomal binding site B) Introns C) Poly A tail D) RNA polymerase E) Primase
C
How is transcription terminated? A) RNA polymerase dissociates into individual subunits. B) When the length of the RNA transcription reaches a maximum, RNA polymerase dissociates from DNA. C) The addition of the poly A tail causes RNA polymerase to dissociate. D) A DNA sequence at the end of a gene encodes a termination signal.
D
RNA polymerase is using the DNA as a template to synthesize the growing RNA strand shown below the DNA template. Another nucleotide is about to be added. Where does the energy come from to make the next phosphodiester bond? DNA-5' CGGAATTCCGGGGGTGCCTTAAG 3' AAGGCCCCCACGG A) NADH B) ATP C) CTP D) UTP E) None of the above
D
Which anticodon would be located on a tRNA charged with Histidine (His)? A) 3' UAC 5' B) 5' CAU 3' C) 5' ATG 3' D) 3' GUA 5' E) 5' GUA 3'
D
RNA polymerase reads a template in the ___________ direction and synthesizes mRNA in the _______ direction. A) 3' to 3'; 5' to 5' B) 5' to 3'; 5' to 3' C) 3' to 5'; 3' to 5' D) 5' to 3'; 3' to 5' E) 3' to 5'; 5' to 3'
E
The A site of the ribosome does which of the following? A) It carries the empty tRNAs that will fall off the ribosome. B) None of the above. C) It holds the growing polypeptide chain. D) It catalyzes the addition of amino acids to the tRNAs. E) It binds the release factor when a stop codon is reached.
E
Which of the following is not needed for correct translation of protein from a mature eukaryotic mRNA molecule? A) Stop codon B) 5' cap C) Exons D) Charged tRNAs E) dNTPs
E