Ch 13 Practice

If the sequence of an RNA molecule is 5'-GGCAUCGACG-3', what is the sequence of the nontemplate strand of DNA? 5'-GGCATCGACG-3' 3'-GGCATCGACG-5' 5'-CCGTAGCTGC-3' 3'-CCGTAGCTGC-5' 3'-CGTCGATGCC-5'

A

In eukaryotic cells, where does the basal transcription apparatus bind? Core promoter Regulatory promoter Terminator Enhancer Ribozyme

A

This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil. RNA only DNA only Both RNA and DNA Neither RNA nor DNA

A

What is the function of eukaryotic RNA polymerase I? Transcription of rRNA genes Transcription of mRNA genes Transcription of tRNA genes Transcription of snRNAs Initiation of transcription (but not elongation)

A

Where are promoters usually located? Upstream of the start site Downstream of the start site Near nucleotide +25 Near the hairpin loop Downstream of the terminator

A

Which of the following statements is TRUE regarding the termination of transcription? In some organisms, transcription terminates thousands of nucleotides past the coding sequence. Transcription typically terminates precisely at the hairpin loop terminator sequence. In prokaryotes, transcription terminates as soon as rho has bound to the RNA. In yeast, transcription terminates as soon as Rat1 has bound to the RNA. Both C and D are correct answers.

A

In eukaryotes, tRNAs are transcribed in the nucleus and function in the nucleus. transcribed in the nucleus but function in the cytoplasm. transcribed in the cytoplasm and function in the cytoplasm. transcribed in both the nucleus and the cytoplasm and function in the cytoplasm. transcribed in the cytoplasm and function in the nucleus.

B

When does sigma factor normally dissociate from RNA polymerase? After transcription has terminated After the process of initiation After the addition of nucleosomes After the binding of rho Following the addition of nucleosomes

B

When this molecule is synthesized, both strands of a DNA molecule are used as a template. RNA only DNA only Both RNA and DNA Neither RNA nor DNA

B

Which of the following RNA molecules are required for the process of translation? crRNA tRNA snRNA snoRNA siRNA

B

Which of the following features is primarily responsible for rho protein to cause termination of transcription? Recognizing unstructured RNA Helicase activity Migrating behind RNA polymerase RNA-binding activity Polymerase activity

B

Which of the following is NOT necessary for RNA polymerase to recognize the promoter of a bacterial gene? Sigma factor Origin of replication -10 consensus sequence -35 consensus sequence

B

Which of the following is NOT required for transcription? Ribonucleotides RNA primers DNA template RNA polymerase Promoter

B

Which of the following is a type of RNA that gets translated? rRNA mRNA tRNA miRNA A, B, and C all get translated.

B

The DNA replication enzyme that most closely resembles RNA polymerase is DNA polymerase I. DNA polymerase III. primase. telomerase. helicase.

C

This molecule is synthesized using triphosphate nucleotides as a substrate for a polymerase enzyme that forms phosphodiester bonds. RNA only DNA only Both RNA and DNA Neither RNA nor DNA

C

Which of the following statements are TRUE regarding transcription in most organisms? All genes are transcribed from the same strand of DNA. Both DNA strands are used to transcribe a single gene. Different genes may be transcribed from different strands of DNA. The DNA template strand is used to encode double stranded RNA. The DNA nontemplate strand is used to encode single stranded RNA.

C

During transcription, which parts of a DNA molecule are transcribed into RNA? All of the nucleotides in DNA on both strands All of the nucleotides on one strand of DNA Only parts of the DNA that encode mRNA Only regions of the DNA that contain genes Only regions of the DNA that encode rRNA

D

If the following DNA strand were used as a template, what would the sequence of an RNA be? 5′ GTACCGTC 3′ 5′ GUACCGUC 3′ 5′ GACGGTAC 3′ 5′ CAUGGCAG 3′ 5′ GACGGUAC 3′ 5′ GUCGGUAC 3′

D

In a transcription reaction, two phosphate groups are cleaved from the incoming deoxyribonucleoside diphosphate. deoxyribonucleoside triphosphate. ribonucleoside diphosphate. ribonucleoside triphosphate. ribozyme.

D

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? It blocks access of RNA polymerase to the promoter, until removed by general transcription factors. It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. It modifies histones so that nucleosomes can be removed from DNA for transcription. It bends and partly unwinds DNA at a promoter. It creates a phosphodiester bond between the nucleotides.

D

This molecule is made of nucleotides joined by phosphodiester bonds that connect the 2′ OH to the 5′ phosphate. RNA only DNA only Both RNA and DNA Neither RNA nor DNA

D

Whereas the nucleotide strand used for transcription is termed the _______, the nontranscribed strand is called the _________. promoter; terminator terminator; promoter transcription apparatus; TATA box template strand; nontemplate strand nontemplate strand; template strand

D

Which statement about RNA polymerase is NOT true? RNA polymerase adds a ribonucleotide to the 3' end of a growing RNA molecule. RNA polymerase binds to a promoter to initiate transcription. During transcription of a gene, RNA polymerase reads only one strand of DNA. RNA polymerase reads a template strand of DNA 5' to 3'. RNA polymerase has many subunits.

D

In prokaryotic RNA polymerases, the holoenzyme consists of the core enzyme and the rho factor. TFIID. TBP. omega subunit. sigma factor.

E

If you wanted to express a eukaryotic gene in E. coli, would the normal promoter be sufficient for transcription? Why or why not?

No. Prokaryotic and eukaryotic promoters have different sequences and different proteins that associate with them.

What are the three different RNA polymerases found in all eukaryotes and what types of genes do they transcribe?

RNA polymerase I transcribes large rRNA. RNA polymerase II transcribes pre-mRNA,some snRNA, snoRNAs, some miRNAs RNA polymerase III transcribes tRNA, small rRNA, and some snRNAs, some miRNA

What would you add to an in vitro transcription system that contains a Drosophila gene for glyceraldehyde 3-phosphate dehydrogenase, an enzyme in glycolysis, in order to get basal transcription?

RNA polymerase II Basal transcription factors (TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIH) Ribonucleoside triphosphates with A, C, G, and U bases (rNTPs)

Compare rho-dependent and rho-independent transcription termination in terms of their use of RNA secondary structures.

Rho-dependent transcription termination relies on a lack of RNA secondary structure so that rho can bind the RNA, move up to the RNA polymerase, and remove the RNA from the DNA template. Rho-independent transcription termination relies on a hairpin in the transcribed RNA that causes RNA polymerase to pause, facilitating termination.

A new mutation in Saccharomyces cerevisiae, a eukaryotic yeast, causes the cells to be unable to produce the amino acid histidine. Specifically, they cannot catalyze the first reaction in the histidine biosynthesis pathway. When examined closely, they are producing a completely wild-type enzyme for this reaction, but at greatly reduced levels. Explain the mutation.

The mutation is either in the regulatory promoter for the gene or in an enhancer, reducing transcription.

What is the RNA sequence transcribed from the DNA shown below? promoter +1 5′ GTAACTATAATTAACGTAAGACTAT 3′ 3′ CATTGATATTAATTGCATTCTGATA 5′

5′ GUAAGACUAU 3′

An in vitro transcription system that contains a bacterial gene initiates transcription, but from random points on the DNA. Which of the following proteins most likely is missing from the reaction? Sigma factor Rho factor RNA polymerase II TATA-binding protein (TBP) TFIID

A

In transcription, to which end of the elongating strand are nucleotides always added? 3′ 5′ 3′ in prokaryotes and 5′ in eukaryotes It depends on which RNA polymerase is being used. It depends on which DNA strand is being used as the template.

A

In which of the following organisms would transcription be the LEAST similar to archaea? E. coli Yeast Plants Mice Humans

A

Over time, DNA replaced RNA as the primary carrier of genetic information, and the chemical stability of DNA is believed to be the key reason for this. Which attribute of DNA is the reason behind its chemical stability? DNA lacks a free hydroxyl group on the 2′-carbon atom of its sugar. Unlike RNA, DNA is usually double-stranded. DNA does not usually form hairpin loops. One of the two pyrimidines found in DNA does not involve uracil. DNA contains thymines, which make it more chemically stable.

A

Which process is illustrated in the diagram below? Transcription Translation RNA processing Replication Nucleosome assembly

A

Describe how the activities and requirements of prokaryotic RNA polymerase and eukaryotic RNA polymerase II are both similar and different.

Both transcribe mRNA in a 5′ to 3′ direction, use rNTPs as a substrate, use a single DNA strand as a template, and do not require a primer to begin RNA synthesis. They associate with different proteins and bind to different promoter sequences to begin transcription: the prokaryotic enzyme requires the sigma subunit and uses the -10 and -35 sequences; the eukaryotic enzyme requires TBP and a whole host of additional general transcription factors. Additionally, the eukaryotic enzyme uses several different binding sequences like the TATA box, TFIIB recognition element, etc. The eukaryotic enzyme may also interact with enhancer sequences.

The polymerase that synthesizes this molecule uses DNA as a template and synthesizes new strands from 5′ to 3′. RNA only DNA only Both RNA and DNA Neither RNA nor DNA

C

What types of bonds are created between nucleotides during the process of transcription? Ionic Oxygen Phosphodiester Hydrogen Both C and D

C

Which one of the following statements regarding eukaryotic transcription is NOT true? Eukaryotic transcription involves a core promoter and a regulatory promoter. There is no one generic promoter. A group of genes is transcribed into a polycistronic RNA. Chromatin remodeling is necessary before certain genes are transcribed. There are several different types of RNA polymerase.

C

Which of the following is a sequence of DNA where transcription is initiated? Hairpin loop TBP Initiator Sigma factor Promoter

E

If you were asked to isolate total RNA from two unknown samples and then were required to identify if the RNA was from prokaryotes or eukaryotes, what aspects regarding the classes of RNA present would help you distinguish one from the other?

RNA from prokaryotes will contain mRNA, tRNA, and rRNA. In addition to these three types of RNA, eukaryotic samples will contain pre-mRNA, snRNA, snoRNA, scRNA, miRNA, and siRNA. If the eukaryotic sample happens to be from mammalian testes, it will also contain piRNA.

An in vitro transcription system transcribes a bacterial gene but terminates inefficiently. What is one possible problem? There is a mutation in the -10 consensus sequence, which is required for efficient termination. Rho factor has not been added. Sigma factor has not been added. A hairpin secondary structure has formed at the 3′ end of the mRNA, interfering with termination. Histones were added prematurely and interfered with termination.

B

Compare and contrast the operation of promoters and enhancers in affecting transcription of genes in eukaryotes. Include a discussion of how they operate and from what positions with respect to the transcription initiation site and the roles of each in bringing about and regulating transcription.

Both promoters and enhancers are DNA sequences that regulate transcription of adjacent DNA sequences. Both are needed for a high level of transcription of a gene. Both serve as binding sites for proteins that are involved in bringing about and regulating transcription. Promoters are found just upstream of the transcription start site and need to be in a specific orientation with respect to the transcription start site. Eukaryotic promoters typically include a core promoter located just upstream of the transcription start site, as well as a regulatory promoter located immediately upstream of the core promoter. The core promoter allows for binding of the basal transcription apparatus (including RNA polymerase). The core promoter by itself usually can only bring about a low level of transcription. The regulatory promoter allows for the binding of a variety of additional transcription factors that can interact with basal transcription factors at the core promoter to bring about regulated gene expression at a higher level. The activity of promoters is constrained in that they can only operate from a specific position and in a specific orientation with respect to the transcription start site. Enhancers are DNA sequences that can be found near or far from and upstream or downstream of the transcription initiation site. Regulatory proteins bind to enhancers and interact with the transcription apparatus at a promoter to bring about a higher level of transcription. Because of the ability of enhancers to act at various distances and positions with respect to the promoter, a large number of enhancers can be found on a single gene, allowing the gene to be responsive to a variety of different signals and conditions in the cell.

An in vitro transcription system that contains a bacterial gene does not initiate transcription. What is one possible problem? Histones that were on the DNA when it was isolated from E. coli are blocking access to the template. There is a mutation in the inverted repeat sequence that prevents a hairpin secondary structure from forming. There is a mutation at -10, where a promoter consensus sequence is located. Rho factor has not been added. TATA-binding protein (TBP) has not been added.

C

Prokaryotic promoters contain the sequence TATAAT at the position -10 from the transcription start. +1 -1 -10 -25 -35

C

What is the function of general transcription factors? They are DNA sequences to which RNA polymerase binds. They direct nucleosome assembly. They bind to regulatory promoters to increase the rate of transcription. They bind to enhancers to allow minimal levels of transcription. They are a part of the basal transcription apparatus.

E

Which of the following statements is FALSE regarding TFIID? It contains a TATA binding protein. It aids in initiation of transcription. It binds to the core promoter. It binds to the TATA box. It is a transcriptional activator protein.

E

Which of the following statements is NOT true? Both DNA and RNA are synthesized in a 5′ to 3′ direction. During RNA synthesis, the DNA template strand is read in a 3′ to 5′ direction. During RNA synthesis, new nucleotides are added to the 3′ end of the growing RNA molecule. RNA polymerase has 5′ to 3′ polymerase activity. RNA molecules have the same 5′ to 3′ orientation as the DNA template strands to which they are complementary.

E

____________________ probably began the evolution of life on Earth. DNA RNA promoters DNA polymerases RNA polymerases Ribozymes

E

What would you add to an in vitro transcription system that contains an E. coli gene for glyceraldehyde 3-phosphate dehydrogenase, an enzyme in glycolysis, in order to get transcription that begins from the normal transcription start site?

RNA polymerase Sigma factor Ribonucleoside triphosphates with A, C, G, and U bases (rNTPs)

Describe three ways that eukaryotic transcription initiation is different from prokaryotic transcription initiation.

There are many different eukaryotic RNA polymerases. Each recognizes the promoter of a different type of gene. Eukaryotic RNA polymerases require general transcription factors to associate with a promoter. Eukaryotic promoters do not have the same -10 and -35 consensus sequences that prokaryotic promoters have. Eukaryotic RNA polymerases do not have the polymerase subunits that are required for promoter recognition. Eukaryotic transcription initiation requires altering or removing nucleosomes at the gene to be transcribed. The different types of eukaryotic polymerases recognize different promoter sequences.

An RNA molecule has the following percentage of bases: A = 15%, U = 30%, C = 20%, and G = 35%. Is this RNA single-stranded or double-stranded? How can you tell based on the base composition? What would be the percentage of bases in the template strand of the DNA that encodes this RNA molecule?

This RNA molecule must be single-stranded, like most RNA molecules. If the molecule were double-stranded, it would consist of complementary base pairs so that A = U and C = G, which is not the case. The template strand of DNA would be complementary to this RNA molecule, so the composition would be T = 15%, A = 30%, G = 20%, and C = 35%.

You analyze a newly cloned eukaryotic gene by comparing the DNA sequence of the gene to the sequence of the transcribed RNA and find that it does not contain recognizable promoter sequences upstream of its coding sequence. How can you explain this result, and how might you confirm your hypothesis?

This gene is most likely a polymerase-III-transcribed gene that contains an internal promoter. In order to confirm this hypothesis, look for known polymerase III promoter sequences within the coding sequence.

How are enhancers different from promoters?

Unlike for promoters, the distance between enhancers and the gene they influence is not critical. Enhancers may affect several genes in their vicinity. Enhancers may be downstream or upstream of the genes whose transcription they affect.

Transcription of a gene using what is normally the nontemplate strand can be accomplished using standard genetic engineering techniques to move the promoter. The resulting RNA is called "antisense RNA." Antisense RNA is often used to prevent production of a protein. Explain how antisense RNA would interact with RNA normally made by the gene, and how this would interfere with protein production.

Antisense RNA would bind to the normal RNA from a gene because it would be antiparallel and complementary. The double-stranded RNA would not be able to be translated, so the protein encoded by the gene would not be produced.

The discovery of ribozymes led to the theory that the evolution of life on earth began with an "RNA world." Describe the chemical properties and functions of RNA that would allow it to be the basis of the first self-replicating systems.

As a nucleic acid, RNA can serve as a template for self-replication: An RNA can be copied into a complementary strand that is a template for generating more of the original RNA. As a nucleic acid, RNA can carry genetic information in its base sequence. RNA could have performed the reactions required of a self-replicating system because RNA ribozymes have catalytic activity.

In eukaryotes, which RNA polymerase transcribes the genes that encode proteins? RNA polymerase I RNA polymerase II RNA polymerase III RNA polymerase IV RNA polymerase V

B

In prokaryotes, rho-independent transcription termination depends on a secondary structure formed in the RNA polymerase that is transcribing the gene. the DNA template. the RNA that is being transcribed. a protein factor that binds to RNA polymerase. a protein factor that binds to the RNA that is being transcribed.

C

Histone acetyltransferases add acetyl groups to lysines, which are positively charged amino acids. How might this affect the association of a nucleosome with DNA?

DNA is negatively charged. Acetylating lysines would neutralize the positive charge, which would allow them to form ionic bonds with DNA. Nucleosomes that contain histones with a reduced ability to bond with DNA would be less tightly associated with DNA.

Organisms belonging to the archaea group possess a TATA-binding protein (TBP), but they are structurally very similar to members of the eubacteria (i.e., contain no nucleus, are single-celled). What does this conundrum mean regarding the evolutionary relationships among the archaea, eubacteria, and eukaryotes?

It suggests that the archaea and eukaryotes are more closely related to each other than the archaea are to the eubacteria.

If you remove the TATA box and place it immediately upstream of a transcription start site of a eukaryotic gene, and subsequently transcription of the mRNA is assayed, will you still achieve transcription from the same start site?

No. The TATA box needs to be present a certain number of nucleotides upstream of the transcription start site to allow enough space for the assembly of TATA-binding protein and other transcription factors on the core promoter. The RNA polymerase can then be placed appropriately over the transcription start site.

The discovery of ribozymes led to the theory that the evolution of life on Earth began with an "RNA world." What properties of proteins and DNA make them more suitable than RNA as enzymes and the cell's genetic material?

Proteins are made of 20 different amino acids; RNA is made of relatively uniform nucleotides with only four different bases. Because they can be more chemically diverse, proteins are better suited to catalyzing a variety of cellular reactions. DNA is double-stranded, with a structure that protects the molecule from degradation. The lack of 2′ OH makes the molecule less susceptible to self-hydrolysis. Because it is more stable, DNA is a better molecule for the cell's genetic material.

The discovery of ribozymes led to the theory that the evolution of life on earth began with an "RNA world." Describe how the current cellular roles of RNA support this theory.

RNA is an intermediate between DNA, the permanent genetic information, and proteins. RNA has a role as a primer for DNA replication. RNA is required for protein synthesis as mRNA, rRNA, and tRNA.

Explain why eukaryotic transcripts from the same RNA-polymerase-II-transcribed gene may vary in the sequences at the 3′ end.

The 3′ end is the termination end. Termination on polymerase-II-transcribed genes can occur at multiple sites. RNA polymerase transcribes until the 3′ end is processed by a cleavage complex. The complex may prevent termination until the processing sequence is transcribed and the complex can cleave the 3′ end of the new RNA.

An in vitro system to detect transcription initiation functions if protein extracts from either eukaryotic or archaebacterial cells are added. Initiation does not occur if extracts from eubacterial cells are added. What does the protein extract contain? Explain the results using the different sources of protein extracts.

The extracts that work contain a TATA-binding protein (TBP). Eukaryotic and archaebacterial cells use a TBP (and its associated transcription factors, TFIIB); eubacterial cells do not.

Two sequences of a prokaryotic promoter are shown below. Sequence 1 is the wild-type sequence, and sequence 2 is a mutant sequence (mutation shown in bold) that results in increased transcription of the gene. Explain why sequence 2 shows this phenotype. Sequence 1 Sequence 2 -10 -10 ...CGAATAATGAA... ....CGTATAATGAA...

The mutation changes the -10 Pribnow box so that it exactly fits the consensus sequence for RNA polymerase binding.

Your goal is to achieve a high level of transcription—a level similar to its in vivo levels—of a eukaryotic gene in an in vitro transcription system. You add the DNA template for this gene, which contains the following, to the in vitro transcription system: a TATA box sequence located -25 to -30 bp upstream of transcription start site, the sequence for the gene, and terminator sequences. How would you interpret the result if you do not get high levels of RNA transcription, and what corrective measures would you take to achieve your goal?

Two causes contributed to the low level of transcription and need to be corrected: (a) The template did not include regulatory promoter regions including enhancers. (b) The regulatory proteins that bind to the enhancers and activate high levels of transcription are absent in the in vitro system.