Biology Final Exam
Which of the following shows the BEST example for the indicated energy transformation?
Dropping a pencil: potential energy→ kinetic energy
Which of the following characteristics is NOT shared by bacteria and archaea? Selected Answer: identical cell wall composition
identical cell wall composition
nuclues
physically separate the DNA from most metabolic processes
The first law of thermodynamics means that:
plant cells cannot create their own energy
When a macromolecule goes through complete hydrolysis, the products are
polymers
the smallest biological units that can evolve are
populations
Which level of protein structure is the overall 3-D shape of a polypeptide?
primary
What is one major difference between prokaryotes and eukaryotes?
prokaryotes are MUCH older than eukaryotes
Histone acetylation ________ transcription; whereas DNA methylation _________ transcription.
promotes; reduces
centrosome movement
prophase I
golgi apparatus
protein, glycoprotein and phospholipid modification
What is so unique about the chemistry/ecology of serpentine soils?
they are extremely deficient in essential plant nutrients
Which of the following is an example of potential rather than kinetic energy?
a molecule of glucose
which of the following does not completely follow Mendel's laws
co-dominance
When an enzyme speeds up metabolic reactions,
it lowers the activation energy necessary to break the bonds of the reactants.
Which of the following is NOT true about the Kreb's Cycle
it occurs in the cytoplasm so every living organism can do it
What type of covalent bonds exist in methane?
nonpolar
which of the following is a correct match of monomer and macromolecule
phospholipid -- DNA
pollen from a pea plant with a mutation in the mitochondrial DNA is used to fertilize a pea plant that has no mutation. What percentage of progeny in the F2 generation is expected to have the mutation?
0%
as defined in biology class, what is the valence number of nitrogen
10
You discover a new organism and analyze its DNA. If you find 40% of nucleotides are G, which of the following is true:
10% are A
Substrate-level phosphorylation accounts for approximately what percentage of the ATP formed by the reactions of glycolysis?
100%
a solution with a pH of 9 has how many H+ ions in it compared to a solution with a pH of 6
1000 times less
If the H+ ion concentration of a household item is 10-3, how many OH- ions does it have?
10^-11
given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have?
11
In the absence of oxygen, suppose a single yeast cell undergoes fermentation and uses 56 molecules of glucose. How many molecules of ATP will be generated?
112
In a species of fly, smooth wings (W) are dominant to wrinkled wings (w) and red bodies (R) are dominant to yellow bodies (r). WwRr and wwrr fly mate and produce the following offspring: Phenotype / Number of Offspring Smooth, red / 778 Smooth, yellow / 162 Wrinkled, red / 158 Wrinkled, yellow / 785
17% Total # in population = 778+162+158+785 = 1883 Total # of recombinants = 162+158=320Therefore # of recombinants = 320/1883 = 16.9999% or 17%
What is the molecular weight of Glucose? C6H12O6 (C = 12; H = 1; 0 = 16)
180 g/mol
A particular eukaryotic protein is 800 amino acids long. Which of the following could be the maximum number of nucleotides in the coding sequence of the mature mRNA that codes for the amino acids in this protein?
2,400
How much NaCl would you need to make a 0.100 L (100 ml) of a 0.5 molar solution? NaCl has a molecular weight of 58.44 g.
2.9 g
The brown-eye allele is dominant over blue-eye allele. A couple currently has 3 children with brown eyes. What is the probability that their next baby will have blue eyes if both parents are heterozygous for eye color?
25%
An aqueous 2 M solution of hydrochloric acid is prepared with a total volume of 0.350 L (350 ml). The molecular weight of hydrochloric acid is 36.46 g/mol. How much hydrochloric acid (in grams) is needed for the solution?
25.5 g
How many different genotypes are possible to produce from a self-fertilization of a plant with genotype AaBbCc?
27
The fluid inside a thylakoid of a chloroplast has 1000 times the concentration of H+ ions as the fluid in the stroma of the chloroplast. If the stroma fluid is pH 7.5, what is the pH of the thylakoid fluid?
3.5
A particular triplet of bases in the template strand of DNA is 5′-AGT-3′. What would be the corresponding codon for the mRNA that is transcribed?
3′-UCA-5
If liver cells (somatic) of turkeys have 80 chromosomes, how many chromosomes do its sperm cells (germ-line) have?
40
if a DNA sample were composed of 10% thymine, what would be the percentage of guanine
40%
Cats have 20 pairs of autosomes and a pair of sex chromosomes. How many chromosomes would cells have at the end of mitosis (diploid number) and at the end of meiosis (haploid number), respectively?
42 and 21 (There are 21 pairs of chromosomes. At the end of mitosis, there would be 42 individual chromosomes (diploid, 2n). At the end of meiosis, there would be 21 individual chromosomes (haploid, n).)
Which of the following sequences is complementary to the DNA strand with sequence: 5' -TCCGAGCTA- 3'?
5' -TAGCTCGGA- 3'
Below is a piece of double stranded DNA. If RNA polymerase is moving from left to right (direction of the arrow), what is the product? 3'-GGACT-5' 5'-CCTGA-3'
5'-CCUGA-3'
A 0.250 L (250 ml) sample of seawater contains 77.4g of NaCL, which has a molecular weight of 58.44 g/mol. What is the molar concentration of the NaCl in the seawater?
5.3 M
Phoebe's mother is red-green colorblind and her father is not. What is the probability that Phoebe's son is red-green colorblind?
50%
Under aerobic conditions, _____ moles of CO2 are produced for each mole of glucose oxidized. (Enter a number below.)
6
How many grams of the compound in the figure above would be required to make 2.5 L of a 1 M solution? (Atomic masses of carbon = 12, oxygen = 16, hydrogen = 1)
60
In a genetic cross between a heterozygous tall plant with homozygous purple flowers and a homozygous short plant with heterozygous purple flowers, how many short plants will you expect in the next generation if you sample 16 individuals? Both tall and purple flowers are dominant.
8
Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine?
8%
) Dopamine is a neurotransmitter that functions as part of the reward-motivation behavior pathway. Which of the following is NOT true about this chemical?
A) None of the above, they are all true about dopamine B) Can increase urine output C) It can be used as a vasodilator (to widen blood vessels) D) Some people make too much have to take medication to decrease their levels E) It is only found in the brain
Why is the one gene-one enzyme hypothesis is not entirely accurate?
A, B, and C
A cell uses one ATP molecule to help reactants X and Y form a product X-Y. What is left of the ATP after this reaction?
ADP and a phosphate group
What is the source of energy during the energy investment phase of glycolysis
ATP
The primary products produced by the light reactions and required by the dark reactions are which of the following?
ATP and NADPH
Eukaryotic cells use millions of ATP molecules per minute. How does the cell constantly replenish its ATP supply to keep up with this intense demand?
ATP is regenerated by adding a phosphate group to ADP during the process of cellular respiration
You can make a cell extract that is able to perform glycolysis in vitro (in a test tube) if glucose is added. Arsenate is a potent inhibitor of triose phosphate dehydrogenase, the enzyme required for the 6th step in glycolysis. If both arsenate and glucose are added to the cell extract, what happens?
ATP levels decrease
one can measure ATP production from isolated mitochondria in vitro (in a test tube). Changing the pH of the solution that the mitochondria are in results in a similar change the pH of the intemembrane space. If the pH of the solution that the isolated mitochondria are in is raised and everything else remains constant, what is the effect on ATP synthesis?
ATP synthesis is decreased
During cellular respiration, what happens to the 6 carbons in glucose?
All 6 carbons are completely oxidized to CO2.
Which of the following statements is TRUE?
An isolated system cannot exchange either matter or energy with its surroundings.
The construction of macromolecules requires a series of ______________ reactions that form _____________ bonds between monomers.
hydrolysis: polymer
A father with blood type O and a mother with blood type AB have 2 children. One child has blood type A. Which of the following is a possible blood type of the other child?
B
Five dialysis bags, constructed of a type of membrane that is permeable to water and impermeable to sucrose, were filled with various concentrations of sucrose and then placed in separate beakers containing an initial concentration of 0.6 M sucrose solution. At 10-minute intervals, the bags were massed (weighed), and the percent change in mass of each bag was graphed. Which line in the graph represents the bag that contained a solution isotonic to the 0.6 M solution at the beginning of the experiment?
C ( the flat one)
What would be the molecular formula for a polymer made from eight glucose (C6H12O6) molecules linked together by dehydration reactions?
C48H82O41
what major event happens during the Calvin cycle
CO2 is fixed by RUBISCO
Arrange the following molecules according to increasing rate of diffusion across a lipid bilayer without the aid of any membrane protein: glucose, Ca2+ N2, H2O.
Ca2+ < glucose < H2O < N2
Which of the following effects might be caused by reduced or very little active telomerase activity?
Cells age and begin to lose function.
Which of the following DOES NOT support the endosymbiotic theory?
Chloroplasts and mitochondria have the same sizes.
which of the following best describes the difference between DNA and RNA
DNA is a very stable molecule, RNA is very unstable (ever changing, degrading).
what is one major difference between RNA and DNA
DNA is very stale, RNA is very unstable
in what way does RNA differ from DNA
DNA is very unstable and will denature very quickly
A biochemist isolates, purifies, and combines in a test tube a variety of molecules needed for DNA replication. When she adds some DNA to the mixture, replication occurs, but each DNA molecule consists of a normal strand paired with numerous segments of DNA a few hundred nucleotides long. What has she probably left out of the mixture?
DNA ligase
which of the following is true
Functional groups cause particular properties and reactions to occur when added to basic chains of carbon molecules.
Of the following cell components, which group comprises the endomembrane system?
Golgi apparatus, vacuole, endoplasmic reticulum
Which of the following statements correctly describes the structure or function of chromatin?
Heterochromatin is highly condensed, whereas euchromatin is less compact.
What is NOT true about this guy?
His is a very famous botanist from The University of Texas Austin.
Which of the following is FALSE about glycogen as a storage polysaccharide?
Hydrolysis of glycogen releases fructose, a sugar that is sweeter than glucose and thus gives off more stored energy.
Put the following events in the order they occur during translation:I. mRNA binds to small ribosomal subunitII. Initiator tRNA, carrying the amino acid MET, binds to the start codon on the mRNAIII. a tRNA binds in the A site in the ribosomeIV. Large ribosomal subunit binds to complex
I, II, IV, III
What do mitochondria and chloroplasts have in common? I. double membrane II. make sugar from air and light III. found in almost all animal cells IV. found in almost all plant cells V. evolution from endosymbiotic events
I, IV, V
Which of the following is true of osmosis?
In osmosis, solutes move across a membrane from areas of lower water concentration to areas of higher water concentration
pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following?
Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.
In liver cells, the inner mitochondrial membranes are about five times the area of the outer mitochondrial membranes. What purpose must this serve?
It increases the surface for oxidative phosphorylation.
Shown below is a structure of the chitin monomer. Which of the following is TRUE regarding chitin?
It is similar to cellulose except for the group shown by the arrow in the chitin monomer structure.
What is unique about 14C and how many protons does it have?
It is stable and has 6 protons
Which of the following does NOT describe a biological membrane?
Its protein and lipid components are symmetrically distributed.
As you were taking lettuce in the grocery store, you were surprised when water sprinklers suddenly went on, spraying fresh water on the produce. When you got back home, you immersed the lettuce in a salt solution, and within several minutes they became limp and soft. What are the explanations for the spraying procedure in the store, and your observation at home?
Lettuce cells are hypertonic to fresh water making them turgid and fresh-looking, but hypotonic to the salt solution, hence plasmolyzed.
which of the following DOES NOT support the fluid mosaic model?
Membrane proteins from cells of two different organisms will never be found mixed together in a hybrid cell.
In his transformation experiments, what phenomenon did Griffith observe?
Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form.
The genetic code is redundant. What is meant by this statement?
More than one codon can specify the addition of the same amino acid.
Refer to the plot showing the rate of an enzyme-catalyzed reaction as a function of substrate concentration. Why is the curve starting to level off?
Most of the active sites of the enzyme are occupied by the substrate.
In oxidative phosphorylation, what is being oxidized and what is being phosphorylated?
NADH : ADP
what is true about DNA
Nearly every single organism alive use the same exact genetic code
Which of the following is NOT TRUE for mitosis?
Non-sister chromatids exchange DNA
Household bleach has a pH = 12. How many OH- ions and H+ ions does it have, respectively?
OH = 2 ; H = 12
Ribosomes are composed of ______________ and directly synthesize ________________.
RNA and proteins ; polypeptides
Despite the human genome being significantly larger than the genome of bacteria such as E. coli, it does not take a human cell significantly longer to replicate its genome. Why?
Replication in human chromosomes uses multiple origins of replication that move in both directions along the DNA
List all possible gametes produced by a plant with genotype RrYy.
Ry, ry, RY, and rY
Taxol is a drug that comes from the bark of a tree that binds and irreversibly stabilizes microtubules. It is often used during chemotherapy to kill dividing cancer cells. How does taxol block cell division?
Taxol prevents spindle formation and separation of chromatids.
Telomere shortening puts a limit on the number of times a cell can divide. Research has shown that telomerase can extend the life span of cultured human cells. How might adding telomerase affect cellular aging?
Telomerase greatly reduces telomere shortening and slows aging.
A new, lethal genetic disorder has been discovered. The disease allele is dominant, yet it persists in the population. The simplest reason to explain this disease allele is:
The allele is dominant, but affects individuals beyond the reproductive age.
In Engelmann's experiment, he places a filament of green algae on a slide and then created a light spectrum across the slide using a prism. He then "painted" the slide with oxygen-dependent bacteria and discovered what?
The bacteria grew best in the blue and red portions of the spectrum.
Which of the following statements is a reasonable explanation for why unsaturated fatty acids help keep a membrane more fluid at lower temperatures?
The double bonds form kinks in the fatty acid tails, preventing adjacent lipids from packing tightly.
Which of the following DOES NOT pertain to the first law of thermodynamics?
The energy of the universe is never constant.
Imagine that you've isolated a yeast mutant that contains histones resistant to acetylation. What trait/characteristic would you predict for this mutant?
The mutant will show decreased levels of gene expression.
Which most accurately describes the why leaves change color in fall?
The plant stops making cholorphyll and the accessory pigments that were already there become visible.
A patient experienced great blood loss. In an attempt to quickly replenish body fluids, a volume of distilled water equal to the blood lost was introduced directly into a blood vein. What is the most likely result of this treatment?
The red blood cells are in danger of bursting because they were subjected to a hypotonic environment.
The yeast Saccharomyces cerevisiae is a single cell organism that can grow and divide under either aerobic or anaerobic conditions. The rate of cell division is limited only by the cell's ability to generate the energy required to synthesize and duplicate necessary macromolecules. Using the following growth curves, which statement is correct?
The red circle line was the result of yeast growing aerobically and the orange square line was from cells grown anaerobically.
When you put aspirated spinach leaf disks in a beaker of sodium bicarbonate and place them in different colors of light, some disks float faster & more abundantly than others dependent on what color, if any, they were in. What made them able to float?
The release of O2 from the process of photosynthesis.
Which of the following does not take place during the S-phase of the cell cycle?
The spindle is formed in preparation for chromatid separation.
Alfred Wallace is best known for what?
The theory of endosymbiosis leading to the evoluton of the mitochondria & cholorplast.
Which of the following is FALSE regarding the DNA double helix?
The two strands are parallel.
What is one major difference between mitosis and prophase I of meiosis?
There is crossing over in meiosis only
which of the following is true about bacteriophages
They can be used to kill bacteria that have acquired antibiotic resistance.
Bacteriophages are viruses that infect bacteria and destroy them. Which of the following is NOT true about the phages?
They cause many human diseases
Ultraviolet exposure can commonly result in which of the following forms of DNA damage?
Thymine dimer formation
Enantiomers are isomers that are mirror images of each other. Why are they SO important?
To the pharmaceutical industry as one will be effective, the other will not.
Two pea plants were crossed and 93 of 200 progeny were short and the rest were tall. Tall is dominant. The most likely genotypes of the parents are:
Tt and tt
translation is a molecular process that
Uses the information in an mRNA sequence to synthesize a protein
Which of the following is an example of cooperativity?
a a molecule binding at one unit of a tetramer, allowing faster binding at each of the other three
Which of the following is not common to both prokaryotic and eukaryotic cell division?
a checkpoint will be activated if the spindle does not attach to a kinetochore.
A series of enzymes catalyze the reaction X → Y → Z → A. Product A binds to the enzyme that converts X to Y at a position remote from its active site. This binding decreases the activity of the enzyme.With respect to the enzyme that converts X to Y, substance A is best described as being what?
a feedback inhibitor
the genetic code is essentially the same for all organisms. From this, one can logically assume which of the following statements to be true?
a gene from one organism can be introduced in and expressed by another organism
A biologist is studying a cell that has enzymes, DNA, a plasma membrane, ribosomes, and mitochondria . Given only this information, this cell COULD BE
a plant cell or an animal cell but not a bacteria cell
in the genetic code,
a sequence of three bases translates into one amino acid.
Which of the following DNA mutations is most likely to damage the protein it specifies?
a single base-pair deletion
On the basis of energy requirement, which does NOT belong to the group?
active transport
you need to make a half liter of a 1 M solution of maltose for your fermentation lab. how will you do that
add 171 G to 1 L water
Most of the organic material in plants is what? (What are plants made out of?)
air
most of the organic material in plants comes from
air
The Cell Theory is one of the 4 major theories in biology. Which is correct?
all cells have a nucleus
which of following is not a tenet of the cell theory
all cells must have a nucleus
As diverse as life is, there is also evidence of remarkable unity, with characteristics that unite everything from the smallest bacteria to the largest mammal. Which of the following is NOT one of those characteristics?
all living organisms have ribosomes
Nearly every organism functions on a 24 hour cycle. What does this circadian clock control/do?
all of the above
Which of the following is an example of post- transcriptional control of gene expression?
all of the options
which process(es) is/are not found in a photosynthetic cell
all of the options occur in a photosynthetic cell
which of these could lead to conversion of a protoncogene into an oncogene?
all of these
A hereditary disease never passed from father to son is:
an X chromosome linked disease
Which graph best shows the relationship between glucose levels and ATP production by a cell in an otherwise closed system?
anaerobic = dotted line (less than aerobic) aerobic = straight light both negative
homologous chromosomes separate
anaphase I
chromatids separate
anaphase II
In which stage of polymerase chain reaction (PCR) are the specific primers added to the DNA strands?
annealing
Which of the following allows water to move much faster across cell membranes?
aquaporins
The pH of an item is 13. Is this acidic or basic and how many H+ ions does it have?
basic 10^-13
Element deficiencies can cause a lot of issues for all living organisms. What does a lack of Iron (Fe) cause in humans? Pick the alliment that was specifically addressed in class.
birth defect
Which of the following characteristics is NOT shared by bacteria and archaea?
identical cell wall composition
Mendel's law of segregation applies to:
both monohybrid and dihybrid crosses
lysosome
breakdown of ingested macromolecules and other substances
The drug thalidomide has two different enantiomers, which of the following statements is NOT true about this drug?
can be used to treat diseases including leoparsy and breast cancer
Which unique property of water reduces variation in temperature along lake shores and coastal areas?
capillary action allowing water to flow against gravity
which functional group is found in every single simple sugar
carbonyl
pinocytosis
cell continually takes in droplets of extracellular fluid into vesicles
Which of these structures is found in plant cells but not in animal cells?
cell wall
HIV is the virus that causes AIDS. In the mid-1990s, researchers discovered an enzyme in HIV called protease. Once the enzyme's structure was known, researchers began looking for drugs that would fit into the active site and block it. And this strategy for stopping HIV infections is currently successful, and is an example of what phenomenon?
competitive inhibition
the anticodon of a particular tRAN molecules is
complementary to the corresponding mRNA codon
Last week, biolgists in Tel Aviv released a ground breaking discovery. There were the first group to find a multicellular animal that __________?
completely lacks a mitochondrial genome
hypothesis based science requires
control groups
Hydrolysis is involved in each of the following EXCEPT
conversion of glucose to starch
mitochondria
convert energy to forms that cells can use for work
A tall plant has been found, but its zygosity is unknown. Tall is dominant over short height. The following can be done to determine its zygosity:
cross to a true breeding short plant
DNA exchange
crossing over
Which temperature and pH profile curves on the graphs are most likely associated with an enzyme isolated from a human stomach where conditions are strongly acid? (Note: 0C = 32F, 20C = 68F, 40C = 104F, 80C = 176F, and 100C = 212F)
curves 1 and 4
The basis for dividing the prokaryotes into two domains is:
differences in genome sequences
in its simplest and broadest version, how do we define natural selection
differential reproductive success
natural selection is
differential reproductive success of different phenotypes
electronegativity is the attraction of a particular atom for electrons in a covalent bond. which type of bond has the largest difference in the electronegativity of the atoms being joined
hydrogen
Cyanide inhibits the transport of electrons to oxygen. Cyanide is most likely inhibiting:
electron transport chain
Which of the following is true of enzymes?
enzymes increase the rate of chemical reaction by lowering the activation energy
what is produced when yeasts undergo fermentation
ethanol (ETOH)
A chemical reaction that has a negative Δ G is best described as _____ while one with a positive Δ G is _____?
exergonic, endergonic
a photosynthetic plant cell does not need mitochondria
false
Darwin's mechanism for evolution requires
fewer offspring to be produced so there are plenty of resources
Folding in a protein is damaged or destroyed by
hydrogen bonding
Which of the following shows carbohydrates arranged according to increasing number of sugar units?
fructose, sucrose, chitin
Which list ranks the molecules from most information to least information
genome, chromosome, gene, nucleotide
Mating between a tiger and a lion can produce two types of offspring. A mating event between a male tiger and female lion produces a tigon, which is often smaller than either parent. A mating event between a male lion and a female tiger produces a liger, which is much larger than either parent. This is an example of:
genomic imprinting
what is the substrate for the first step in glycolysis
glucose
Pick the metabolic process that is endergonic.
going from CO2 into glucose
a plant placed in which wavelength of light will perform the least photosynthesis
green
Which enzyme would have the most dramtic changes if placed in stomach acid?
green(right)
what improves the productivity of cellular respiration
highly folded surface of the inner mitochondrial membrane
Arrange the events taking place during transcription in order: i) The pre-RNA undergoes processing ii) RNA polymerase moves downstream, unwinding the DNA iii) RNA polymerase binds to the promoter iv) RNA transcript is released and polymerase detaches from the DNA v) Polymerase initiates RNA synthesis at the start point on the template strand
iii, v, ii, iv, i
A researcher found a method she could use to manipulate and quantify methylation in embryonic cells in culture. In one set of experiments, she succeeded in increasing acetylation of histone tails in the chromatin of the cells. Which of the following results would she most likely see in these cells?
increase in gene expression
Consider the reaction profile for three enzymes, A, B and C. A solution with enzyme B and its substrate is kept at pH 4. If a weak base is gradually added to it, the activity of enzyme B will most likely:
increase, then eventually decrease as base continues to be added.
the first stage of translation and transcription is
initiation
What kinds of molecules have the most trouble passing through a cell membrane?
ions
a scientific "theory"
is a carefully-formulated proposition, based on observations, and supported by an accumulation of experimental data.
quaternary structure
is the overall shape of two or more polypeptide chains that associate to form one functional macromolecule.
the idea of emergent properties is a central theme found in biology which is not true about this theme?
it explains how life on earth emerged life's basic characteristics have a high degree of order
Which of the following statements best describes the effect a nonsense mutation would have on a gene?
it introduces a premature stop codon into the mRNA
Which of the following statement about the above transport is INCORRECT?
it is a pump for passive transport of two K+ into the cell and three Na+ out of the cell
Why is molecular oxygen (O 2) so important for plant and animal life on earth
it is needed in the mitochondria in order to extract the greatest amount of ATP from glucose.
Given below is a list of events taking place during translation. Arrange these in proper sequence. i) The anticodon of tRNA base pairs with the mRNA codon at the A site ii) Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site iii) Translocation of tRNA from the A site to the P site iv) A small ribosomal subunit binds with mRNA
iv, i, ii, iii
In taxonomic heirarchy, what is the correct order for the levels of classification of organisms? (Broadest to most specific.)
kingdom, phylum, class, order, family, genus, species
What is produced when animals undergo fermentation?
lactic acid
the energy source for photosynthesis is
light
Which of the following class of biomolecules is NOT considered as a true polymer?
lipids
what is the function of the polysaccharides cellulose and chitin in the cell
long-term storage of energy
Which organelle is responsible for containing degradative enzymes enclosed in a membrane that help remove waste products?
lysosome
peroxisome
metabolic compartment enclosed by a single membrane
Which of the following is NOT considered part of the cell's endomembrane system?
mitochondria
which set of genes is almost always inherited only from the mother
mitochondria genes
at midday (noon), what is happening in the leaf of a plant
mostly photosynthesis
at night, what is happening in the leaf of a plant
mostly respiration
When an error occurs in replication, it changes the nucleotide sequence of the DNA. This phenomenon is called a [A].
mutation
what is true about DNA
nearly every living organism uses the same DNA material
what differentiates a hypothesis from a theory
neither can be refined after the initial experiment has started
n a genetic cross between AaBbCcDdEe and Aabbccddee what fraction of the offspring will be homozygous for all dominant alleles?
none
a point mutation that changes a codon for an amino acid to a stop codon is called
nonsense mutation
If two people with 'sickle-cell trait' have offspring what would be the predicted ratio of phenotypically normal to affected (sickle-cell disease) offspring?
normal: affected = 3:1
Which of the following basic molecular building blocks would be found in chromosomes?
nucleotides and amino acids
As a researcher, you were asked to grow a cell in a medium containing radioactive nucleotides, which then get incorporated into DNA. Upon later examination, the radioactivity appeared to be concentrated in the
nucleus
the genetic code is said to be redundant because
one amino acid can be encoded by more than one triplet codon
In the generic redox reaction: A + B → C + D,
one substrate gains electrons while the other substrate loses electrons.
We discussed auto brewery syndrome while talking about fermentation. Which of the following is NOT true about this condition?
overgrown bacteria mix with carbs to undergo fermentation
NAD+ is the ______ form of NADH while NADH is the _____ form of NAD+.
oxidized: reduced
The final electron acceptor for cellular respiration is:
oxygen
Cells (e.g., bacteria) are ingested for food by other cells (e.g., an amoeba) by which of the following?
phagocytosis
The frequency of a lethal allele in a population is greatest when it is:
recessive
the purpose of a spliceosome is to
remove non-coding portions of RNA
When heterozygous tall plants with purple flowers self pollinate to give rise to tall and dwarf plants with purple flowers, it demonstrates the following:
segregation of alleles
mendel's laws of inheritance are valid for
sexual reproduction
at Starbucks you take 3 packets of sugar and stir them into your cup of coffee until it disappears completely. in the example, the "pre-sugared" coffee is the ______ and the sugar is the ____
solution: solvent
who, among the following, is the most biologically fit individual
someone who does not put their body through the rigor of pregnancy/birth
the end product(s) of photosynthesis in plants are oxygen and sugar stored as
starch
Most of the enzymes in our bodies function at or very close to neutral (pH ~ 7.0). There are a few exceptions. Which area of your body should be an exception to this "rule"?
stomach
vacuole
storage and waste disposal
which of the following is not a function of a lipid
store genetic information
What is the primary benefit of storing energy in the form of sugar rather than ATP?
sugar is much more stable than ATP
receptor-mediated endocytosis
taking in cholesterol for membrane synthesis in humans
Which of the following is FALSE about the relationship between catabolism and anabolism?
the ATP generated from anabolic reactions drives catabolic reactions.
When two alleles express equally in a heterozygous individual then the following is true:
the alleles are co-dominant
A white mouse (bb) mates with a black (BB) mouse and all the babies are gray in color. Which of the following is true for the alleles responsible for coat color of the mice?
the alleles have incomplete dominance
Which of the following statements describes the second law of thermodynamics?
the entropy of the universe never decrease
In a eukaryotic cell, electron transport takes place within:
the inner mitochondrial membrane
The flexibility and fluidity of membranes that contain a large amount of unsaturated fatty acid acyl chains are due to
the kinks caused by the double bonds prevent close packing.
Which of the following is false about the process of DNA replication?
the leading strand is synthesized as a series of segments called the Okazaki fragments.
which of the following is not true of DNA
the nucleotides are bonded in sequence in each strand phosphate to sugar
Which of the following is part of the Cell Theory
the observation that cells arise from division of existing cells
Your patient was involved in a serious accident and lost a large quantity of blood. In an attempt to replenish body fluids, your rookie nurse adds distilled water (equal to the volume of blood lost) to the patient's blood directly via one of his veins, without consulting you. What will be the most probable result of this transfusion?
the patient's red blood cells will swell and possibly burst as the water moves into the cells
Which of the following distinguishes a eukaryotic cell from a prokaryotic cell?
the presence or absence of internal membranes partitioning the cell
What mainly determines whether a molecule will be transported via endocytosis/exocytosis or via passive transport?
the size of the molecule to be transported
both chloroplast and mitochondria have evolved from an endosymbiotic event what is a line of evidence for this theory
they both predate prokaryotic cell
which of the following is not true about hydrocarbons
they have hydrophobic region
Why can certain types of viruses promote cancer in humans especially?
they insert their DNA into the host genome and can cause massive damage.
What is the chromosomal defect associated with Down syndrome, and what is the resulting number of chromosomes in somatic cells?
three copies of chromosome 21, 47 chromosomes total
During photosynthesis, light reactions take place in ____ and the Calvin cycle takes place in _____.
thylakoid: stoma
What is the function of DNA polymerase?
to add nucleotides to the 3' end of a growing DNA strand
the process of converting DNA to RNA is called
transcription
gene expression is often assayed by measuring the amount of mRNA produced from a gene. What level of the control gene expression can be analyzed by this type of assay?
transcriptional control
Below are 3 plant cells. One of these plants has been placed in pure, filtered water. Which is it?
turgid
phagocytosis
vesicle which pinches off does not have a coated pit
Which of the following has the highest entropy?
water at 100C
