Genetics Final- homework questions

C

"Powder puff" chinese crested dogs have a genotype hh. "Hairless" chinese crested dogs have a genotype Hh. Breeders often notice dead puppies in liters of pups from two Chinese crested dogs and have determined that the homozygous dominant genotype is lethal. How would dog breeders get the most Chinese crested "hairless" pups per mating with the fewest dead puppies? A. mate two hairless dogs B. mate two powderpuff dogs C. mate a hairless dog with a powderpuff dog D. Answer A or C E. Answer B or C

A

A family comes into your clinic with late onset Machado-Joseph Disease. The gel shows PCR amplification of the microsatellite closely linked to the disease trait. No recombination between the gene of interest and the microsatellite has occurred in this family. III-1 is a fetus. The "?" and triangle indicate that the sex and the disease status of the fetus are unknown. Based on this pedigree, how is Machado-Joseph disease inherited? A. autosomal dominant B. autosomal recessive C. X-linked dominant D. X-linked recessive

E

A family comes into your clinic with late onset Machado-Joseph Disease. The gel shows PCR amplification of the microsatellite closely linked to the disease trait. No recombination between the gene of interest and the microsatellite has occurred in this family. III-1 is a fetus. The "?" and triangle indicate that the sex and the disease status of the fetus are unknown. Which of the following is most likely true about III-1: A. III-1 is a boy who does not have the disease B. III-1 is a girl who does not have the disease C. III-1 is a boy who has the disease D. III_1 is a girl who has the disease E. The sex of III-1 cannot be determined but he/she does not have the disease F. The sex of III-1 cannot be determined but he/she has the disease

C

A man is born with a mutation in a Y chromosome gene. This mutation will be inherited by: A. all of his female offspring, none of his male offspring. B. some of his male and female offspring C. all of his male offspring, none of his female offspring D. none of his offspring

C

A population of water snakes is found on an island in Lake Erie. Some of the snakes are banded and some are unbanded; the banding phenotype is autosomal recessive. The frequency of the banded snakes on the island is 0.4. There are 500 total snakes on the island. How many snakes are heterozygous for the banging allele? Round to the nearest whole snake. A. 184 B. 200 C. 233 D. 300 E. 316

D

A premature STOP codon can be created by: A. a base substitution B. an insertion mutation C. a deletion mutation D. all of the above

D

A researcher is studying linkage between singed bristles and vestigial wings, and conducted crosses between two different strains of fruit flies. When true-breeding flies with singed bristles (s) and wild-type wings (L) were crosses to true-breeding flies with wild-type bristles (S) and vestigial wings (l), all of F1 offspring had wild-type wings and wild-type bristles. The F1 offspring were crossed to flies with singed bristles and vestigial wings. Which F2 offspring is/are recombinant? A. singed bristles/vestigial wings only B. Singed Bristles/wild-type wings only C. Singed bristles/wild-type wings and wild-type bristles/ vestigial wings D. singed bristles/vestigial wings and wild-type bristles/ wild-type wings

B

A researcher mutagenized a group of butterflies and isolated 6 butterflies with extra-long bodies. Each butterfly has a recessive mutation in only one gene. The researcher performed a complementation test using the 6 butterflies and got the following results: What would be the result if a 5 butterfly were crossed with a 3 butterfly? A. all of the offspring would have extra-long bodies B. all of the offspring would be wild-type C. half of the offspring would have wild-type bodies and half of the offspring would have extra-long bodies D. you need more information to answer this question

D

A single base deletion mutation of "A" nucleotide has occurred at the start codon of the APC2 gene and is passed on to the next generation. This mutation has been named APC2del. IN the offspring that has inherited APC2del, this allele will most likely be: A. not translated B. no transcribed C. not replicated D. none of the above

C

A somatic cell undergoes non-disjunction during mitosis. When this occurs: A. One daughter inherits more than the expected number of chromosomes B. One daughter cell inherits less than the expected number of chromosomes C. Both A & B will occur D. Either A or B will occur but not both

C

A true- breeding white kangaroo rat is crossed to a true-breeding black kangaroo rat and all of the progeny are brown. If the allele for the kangaroo rat shows incomplete dominance, crossing two brown kangaroo rats would result in a ratio of: A. All brown offspring B. 1 white: 1 brown offspring C. 1 white: 2 brown: 1 black offspring D. 1 white: 2 black: 1 brown offspring E. 1 white: 1 black offspring

C

A woman who does not have sickle cell anemia has a sister with sickle cell anemia. Both of her parents do not have sickle cell anemia. This non-affect woman has children with a man from sub-Saharan Africa who does not have sickle cell anemia. However, there is no information about whether this disease runs in his family. Use the Hardy-Weinberg equation with the information that approximately 96% of the people who do not have the autosomal recessive disease sickle cell anemia to determine the probability that the man is a carrier. What is the probability they will have a child with sickle cell anemia? A. 0.25 B. 0.15 C. 0.05 D. 0.4 E. There is not enough information to answer this question

B

About 60% of the base pairs in the human DNA molecule are AT. If the human genome has 3.2 billion base pairs of DNA, about how many times with the Xbal restriction sites be present in the human genome? Xbal restriction site: 5'--TCTAGA--3' 3'--AGATCT--5' A. ~2,073,600 B. ~1,036,800 C. ~518,400 D. ~324,000

B

Below is a cartoon of a replication fork. What letter is the Okazaki fragment?

D

Below is a family impacted by the autosomal recessive disease beta-thalassemia. The man marked in generation II and the woman in generation III, marked with stars, have no family history of the disease. Assume they are not carriers. What is the chance the child in generation IV will be a carrier for this disease? A. 0 B. 1/3 C. 1/4 D. 1/6 E. 2/9

E

Below is a family impacted by the autosomal recessive disease beta-thalassemia. The man marked in generation II and the woman in generation III, marked with stars, have no family history of the disease. Assume they are not carriers. What is the chance the mother in generation I is a carrier for the disease? A. 0 B. 1/4 C. 1/2 D. 2/3 E. 1

C

Below is a metaphase carotene of three different diploid maize cultivars, A188, A632 and B37. The numbers on the top indicated the chromosome numbers: The chromosomes inside this box include: A.sister chromatids B. Homologous chromosomes C. Both sister chromatids and homologous chromosomes

D

Below is a picture of gene, shaded in grey, with three mutations (indicated with rectangles) Mutation # 1 is a mutation in the 5' UTR sequence of this gene. Mutation #2 and Mutation #3 are mutations on eons that code for amino acids. Based on this information, which close-up of the transcription bubble is drawn correctly?

B

For any autosomal microsatellite DNA marker in humans you cannot distinguish between homozygotes and heterozygotes. A. True B. False

E

Guard cells in a leaf and phloem cells in roots perform different functions in a plant. Which of the following is different between guard cells and phloem cells? A. The DNA sequence in each cell B. the set of genes expressed in each cell C. the set of proteins found in each cell D. all of the above are different in the two cell types E. B and C are different in two cell types

D

Guppy tails come in different colors and shapes. Recessive forked tails (f) or smooth (f+) and recessive yellow tails (y) or red (y+) are encoded by linked genes that are 15 cM apart on chromosome 3. You put a smooth tailed, red female that is heterozygous at both loci in a breeding tank with a forked tailed, yellow male: Out of 1000 F1 baby guppies from the breeding tank, approximately how many will grow up to be smooth tailed and red? A. 850 B. 425 C. 150 D. 75

B

Halolubrum lacusprofundi is a cold- adapted extremophile. The "GC content" (Guanine and Cytosine content) of one of its chromosomes is 67%. How much Cytosine will you expect to find on this chromosome? A. 33% B. 33.5% C. 25% D. 16.5%

A

Here is a DNA sequence: 5' CCGTTAAC 3' The following mRNA sequence was produced from the DNA sequence: 5' CCGUUAAC 3' The DNA strand shown is: A. The coding strand B. The template strand C. Neither of the above D. Could be either the coding strand or the template strand, you need more information

B

Here is a cell that will undergo division soon. The chromosome number from a somatic cell of the organism can be represented as 2n=2x=4. Do not worry about recombination in this question What type of cell division is this cell poised to undergo? A. Mitosis B. Meiosis C. could be either meiosis or mitosis D. neither mitosis or meiosis

B

Here is one of two daughter cells in Metaphase II of meiosis Which of the following drawings shows what this cell could have looked like in metaphase I of meiosis? Do not worry about recombination/

C

Here is the sequence around the translation initiation codon (AUG) of a human mRNA: 5'-- AAGGGAUGGAACCUAGC-3' You have isolated a mutant version of the gene encoding this mRNA that contains a frameshift mutation. A one base pair insertion (base pair underlined) occurs after the start codon (AUG). This change generates the mRNA shown below: 5'--AAGGGAUGGAAACCUAGC--3' This mutation will cause a premature stop in: A. replication B. transcription C. translation D. transcription and translation E. replication, transcription and translation

A

How many chromosomes will there be in each cell at the end of this cell division process? A. 2 B. 4 C. 6 D. 8

C

If a human spermatocyte (precursor to a sperm) has a Meiosis I nondisjunction event for the sex chromosome. What are all the possible arrangements of sex chromosomes for the sperm cells produced? A. XY, X, Y B. X, Y C. XY, O D. XX, YY, O E. XXY

D

In a diploid organism, where will you find homologous chromosomes in the same cell? A. G1 phase B. Interphase C. Prophase of mitosis D. all of the above E. none of the above

C

James is a carrier for two autosomal recessive diseases, sickle cell anemia and cystic fibrosis. Mutations in the HBB gene cause sickle cell anemia and mutations in the CFTR gene cause cystic fibrosis. Recessive diseases only appear when both copies of the mutant allele are present. Assume: "A" symbolizes the wild-type HBB allele "a" symbolizes the mutant HBB allele "F" symbolizes the wild-type CFTR allele "f" symbolizes the mutant CFTR allele If meiosis occurs normally, what is the chance that James will pass the "f" allele onto his children? A. 100% B. 75% C. 50% D. 25% E. 0%

C

James is a carrier for two autosomal recessive diseases, sickle cell anemia and cystic fibrosis. Mutations in the HBB gene cause sickle cell anemia and mutations in the CFTR gene cause cystic fibrosis. Recessive diseases only appear when both copies of the mutant allele are present. Assume: "A" symbolizes the wild-type HBB allele "a" symbolizes the mutant HBB allele "F" symbolizes the wild-type CFTR allele "f" symbolizes the mutant CFTR allele What is James' genotype? A. AF B. AAFF C. AaFf D. AAFf E. AaFF

B

Microsatellites are short tandem repeats that are interspersed throughout our genome. We use these microsatellite DNA markers for a variety of genetic tests, from solving crime to tracking disease alles. For any microsatellite DNA marker, what is the maximum number of alleles that you can detect for a diploid individual? A. 1 B. 2 C. 4 D. an infinite number

A

Mutations in p53 are associated with an aggressive form of breast cancer. Normally the p53 protein stops the cell cycle if DNA is damaged. Mutations in the p53 gene prevent the production of the p53 protein. Without a functional p53 protein, cells continue to divide even when there is DNA damage. The p53 gene is likely a: A. Tumor suppressor gene B. Proto-oncogene

C

Mutations in the CFTR gene lead to the homozygous recessive disease cystic fibrosis. Over 1000 mutations have been described that can affect the CFTR protein. You are a genetics counselor and are working with the following 3 couples: Couple #1: had a baby who is homozygous for a missense mutation, which causes a serine to be made instead of a threonine. The structure of serine and threonine is similar, but the change reduces the function of the CFTR protein. Couple #2: had a baby who is heterozygous for a nonsense mutation in the CFTR gene. The other allele is a wild-type allele Couple #3: had a baby with the missense mutation identified in couples #1's baby and the nonsense mutation seen identified in couple 2's baby. Which of the following is most likely prediction of phenotype severity from least to most severe. A. [least severe] couple #1's baby--> couple #2's baby--> couple #3's baby [most severe] B. [least severe] couple #3's baby--> couple #2's baby--> couple #1's baby [most severe] C. [least severe] couple #2's baby--> couple #1's baby--> couple #3's baby [most severe] D. [least severe] couple #2's baby--> couple #3's baby--> couple #1's baby [most severe] E. [least severe] couple #1's baby--> couple #3's baby--> couple #2's baby [most severe]

B

Mutations in the adenomatous polyposis of the colon (APC) gene predisposes a person to colorectal cancer. Below is a DNA nucleotide sequence of the APC gene on the coding strand from a normal individual and an individual who was diagnosed with colorectal cancer. What type of mutation occurred in the individual that has colorectal cancer? note this sequence is from the middle of the APC gene. Please use the first 3 nucleotides for the first codon of this part of the APC gene. Coding strand of a normal individual: 5'- GAG GCG GGT TCA CGA GAG-3' Coding strand of an individual with colorectal cancer: 5'-GAG GCG GGT TGA CGA GAG-3' A. missense B. nonsense C. Silent D. Frameshift

C

Myriad genetics is a company which designs tests for mutations that cause a number of inherited predispositions to cancer syndromes. For which of these families is cancer most likely an inherited predisposition? A. a family where a single member gets a common cancer B. a family where several members get a common cancer later in life C. a family where several members get a specific form of cancer at a young age

A

One form of the autosomal recessive disease sickle cell anemia is caused by a mutation in the middle of the DNA sequence of the hemoglobin gene. If you look at the protein produced from this mutated sequence, and the protein is the wild-type length, what type of mutation is most likely? A. missense B. silent C. Nonsense D. Frameshift E. either answer A or B could be true

C

Purple flowers are dominant over white flowers. The flower color gene is represented with P/p. Serrated leaves are dominant over smooth leaves. The leaf shape gene is represented S/s. You cross a plant with purple flowers and smooth leaves with a plant with white flowers and smooth leaves. 50% of the F1 have purple flowers and smooth leaves 50% of the F1 have white flower and smooth leaves Which of the following are gametes the purple flower with smooth leaves in the F1 generation can make? A. P,s B. P, p s C. Ps, ps D. PPss, Ppss E. PS, Ps, ps, ps

B

RNA interference (RNAi) is a method where you introduce double-stranded RNA in a cell or organism to silence (turn off) a specific gene expression. You use RNAi to target the Mma2 gene in the worm C. elegans. You predict that you will get a: A. wild-type phenotype B. a loss of function phenotype C. a gain of function phenotype

B

Recombination events occur during prophase I of meiosis. Which of the following is true about those recombination events? A. When recombination occurs between sister chromatids, you will likely see a chromosome with a a mix of allele types B. When recombination occurs between homologous chromosomes, you will likely see a chromosome with a mix of allele types C. when recombination occurs between sister chromatids, you will likely see a chromosome with a new mix of genes D. When recombination occurs between homologous chromosomes, you will likely see a chromosome with a new mix of genes

A

Red-green colorblindness is caused by a mutation in a gene on the X-chromosome. Bob (dad) has red-green colorblindness Karen (mom) has color vision. Bob and karen have a biological child named Taylor, who does not have red-green colorblindness. Taylor marries someone who has red-green colorblindness and they have 2 boys and 8 girls. Both boys have red-green colorblindness while all 8 of the sisters has color vision. Taylor is mostlikely: A. the father B. The mother C. Taylor is equally likely to be the father or the more

B

Sally is exposed to a high dose of radiation and she is worried that she: 1) acquired a mutation and 2) could pass the mutation onto her future children In order for sally to pass the mutation onto her future children, she would have to acquire that mutation in the DNA of: A. somatic cells B. germ cells C. both somatic and germ cells D. neither cell types

B

Seeds from a diploid true breeding plant that produces purple flowers were mutagenized. Below are the genotypes and phenotypes of plants generated from this mutagenesis experiment. Assume that the wild-type alleles (uppercase) are dominant to mutant alleles (lower case) and the two genes are not linked.

B

Seeds from a diploid true breeding plant that produces purple flowers were mutagenized. Below are the genotypes and phenotypes of plants generated from this mutagenesis experiment. Assume that the wild-type alleles (uppercase) are dominant to mutant alleles (lower case) and the two genes are not linked. You cross two fully heterozygous purple plants. What ratio of purple- to brown- to orange- flowered plant will you get from this cross? A. 9:6:1 B. 9:4:3 C. 12:3:1 D. 1:1:1

B

Test crosses are done and determine the distance between vestigial and curly is 13 cM. And the distance between bubblegum and vestigial is 7 cM. Which of the following mapes is correct? A. Map #1 B. Map #2 C. You need more information to determine which map is correct

A

The G and B genes are closely linked on the same chromosome. In a cross which of the following is true about the gametes produced by the F1 progeny: A. GB & gb gametes will outnumber Gb & gB gametes B. Gb & gB gametes will outnumber GB a& gb gametes C. GB, gB, Gb & gb gametes will be present in equal numberes D. GB, gB, Gb, & gb will be present in the ratio 9:3:3:1

B

The HPC1 gene has been implicated in early onset prostate cancer. This is a pedigree of a family showing the incidence of prostate cancer with a particular HPC1- allele . HPC1+/HPC1- males that have this HPC1- allele have a high chance of developing early onset prostate cancer, so you can assume that the disease is fully penetrant in males in this family and any males who join the family. Females do not get prostate cancer. Female 1-4 is HPC1+/HPCI+. HPC1-/HPC1- individuals do not exist in this family. II-2 has a son with Booby. Bobby does not have early onset prostate cancer or any family history of the disease. What is the chance their son will develop early onset prostate cancer if the disease is fully penetrant? A. 0% B. 25% C. 50% D. 66.7% E. 100%

A

The HPC1 gene has been implicated in early onset prostate cancer. This is a pedigree of a family showing the incidence of prostate cancer with a particular HPC1- allele . HPC1+/HPC1- males that have this HPC1- allele have a high chance of developing early onset prostate cancer, so you can assume that the disease is fully penetrant in males in this family and any males who join the family. Females do not get prostate cancer. Female 1-4 is HPC1+/HPCI+. HPC1-/HPC1- individuals do not exist in this family. Which mode of inheritance is most consistent with the information above? A. autosomal dominant B. autosomal recessive C. X-linked dominant D. x-linked recessive E. y-linked

B

The HPC1 gene has been implicated in early onset prostate cancer. This is a pedigree of a family showing the incidence of prostate cancer with a particular HPC1- allele . HPC1+/HPC1- males that have this HPC1- allele have a high chance of developing early onset prostate cancer, so you can assume that the disease is fully penetrant in males in this family and any males who join the family. Females do not get prostate cancer. Female 1-4 is HPC1+/HPCI+. HPC1-/HPC1- individuals do not exist in this family. You sample 10 of persons I-3's non-cancerous somatic cells. What you would expect to find in these cells? A. two wild-type copies of the HPC1 gene B. one wild-type copy and one mutant copy of the HPC1 gene C. two mutant copies of the HPC1 gene

D

The R gene is important for seed texture and the Y gene is important for seed color in peas. You do the following cross, what are the possible gametes produced by the F1 peas? A. rryy, RrYy, RRYY B. R, r, Y, y C. Rr, Yy, RR, rr, YY, yy D. RY, Ry, rY, ry

B

The Y and A genes are closely linked on the same chromosomes and little recombination occurs. An individual has the genotype shown below: The parallel lines represent homologous chromosomes. What is true about the gametes this individual can produce? A. yA and Ya gametes will outnumber YA and ya gametes B. YA and ya gametes will outnumber yA and Ya gametes C. YA, ya, Ya and yA gametes will be produced in equal numbers

B

The diagram below shows the DNA sequence and the entire mRNA sequence for the Sca2 gene Which of the following is true about the DNA? A. the top strand is the coding strand B. the bottom strand is the coding strand C. you need more information

C

The disease Adrenoleukodytrophy (ALD) occurs when there is an accumulation of long fatty acid chains in the body. ALD results in neurodegeneration and problems with vision, hearing and motor coordination. In drosophila, the bubble gum gene is similar to the human gene that when mutant causes ALD. mutations in the bubblegum result in fly vision defects. Mutations in the curly gene results in curly wings. You want to study the linkage between bubblegum and curly so you do this cross: What is the map distance between bubble gum and curly? A. 9.9 cM B. 10.1 cM C. 20.0 cM D. 39.5 cM E. 40.5 cM

B

The disease Adrenoleukodytrophy (ALD) occurs when there is an accumulation of long fatty acid chains in the body. ALD results in neurodegeneration and problems with vision, hearing and motor coordination. In drosophila, the bubble gum gene is similar to the human gene that when mutant causes ALD. mutations in the bubblegum result in fly vision defects. Mutations in the curly gene results in curly wings. You want to study the linkage between bubblegum and curly so you do this cross: Which classes of progeny are the parental types? A. Wild-type & vision defects, normal wings B. Wild-type & curly wings, vision defects C. vision defects, normal wings & curly wings, normal vision D. Curly wings, vision defects & curly wings, normal vision

C

The enzyme glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as a recessive gene on the X chromosome in humans. Below is a pedigree of a family affected by G6PD. X-presents a mutant X chromosome. II-2 has a child with a man that is not affected by G6PD. She is pregnant with their first child. Genetics tests informed her that her child is a boy. What is the probability that her male child with have G6PD? A. 0 B. 1/4 C. 1/2 D. 3/4 E. 1

B

The following DNA sequence comes from the middle of an open reading frame of a gene. The gene has no intron sequences. 5' ATGATAGTTACCGTCTAGAGA 3' 3' TACTATCAATGGCAGATCTCT 5' If the DNA sequence encodes the following amino acid sequence Ser, Leu, Asp, Gly, Asn, Tyr, HIs The direction of transcription is from: A. left to right B. right to left C. cannot be determined

D

The gel below was generated by the dideoxy sequencing Sanger method. The lanes are labeled with the radioactive dideoxynucleotide present in that reaction. What would happen if you forgot to add dNTPS to all the sequencing reactions above? A. nothing, it would look the same B. there would be no bands in all the columns C. There would only be a single band in the "T" D. There would only be a single band in "G"

B

The gel below was generated by the dideoxy sequencing Sanger method. The lanes are labeled with the radioactive dideoxynucleotide present in that reaction. What would happen if you forgot to add the radioactive ddATP to the sequencing reaction above? A. nothing, it would look the same B. There would be no bands in the "A" column, but everything else would look the same C. There would be only bands in the "A" column D. There would be no bands in the "T" column, but everything else would look the same E. There would only be bands in the T column

B

The gel below was generated by the dideoxy sequencing Sanger method. The lanes are labeled with the radioactive dideoxynucleotide present in that reaction. Based on the information from the gel, what is the double stranded DNA sequence? A. 5' TCATTAGACG 3' 3' AGTAATCTGC 5' B. 5' GCAGATTACT 3' 3' CGTCTAATGA 5' C. 3' AGTAATCTGC 5' 5' TCATTAGACG 3' D. 5' CGTCTAATGA 3' 3' GCAGATTACT 5'

C

The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems ribosomes, amino acids, and buffers that support translation are added to a tube. There is no control over which bases start translation. What peptides will not be produced in an in vitro system if the following oligonucleotide were added 5' AAAAAAAAAUAAAAAAAA 3' A. Lys-Lys-Lys B. Lys-Lys-Asn-Lys-Lys C. Lys-Lys-Lys-Lys-Lys D. Lys-Lys-Ile-Lys-Lys

B

The microsatellite allele that is linked to the disease phenotype is also the allele of the gene that causes the disease. A. True B. False

A

The primer used in sanger sequencing: A. has a nucleotide sequence that is complementary to the 3' end of the region to be sequenced B. has a nucleotide sequence that is complementary to the 5' end of the region to be sequenced C. either arrangement is possible

C

This cell is in what stage of mitosis? A. prophase B. Metaphase C. Anaphase D. Telophase

A

This is the template strand of the entire t-RNA gene, At1g01890, from arabidoposis thaliana. 5'CGCCCACCGTGGGGCTCGAACCCACGACCAC*AAG*GTTAAGAGCCTTGCGCTCTACCAACTGAGCTAGACGGGC 3' The bases that will become the anticodon have stars around it. What is the anticodon sequence for the t-RNA derived from At1g01890 and which amino acid will the mature t-RNA be charged with? A. 5' CUU 3', lysine B. 5' UUC 3', leucine C. 5' AAG 3'. glutamic acid D. 5' GAA 3', phenylalanine

C

Tongue Rolling, R= ability to roll tongue, r= cannot roll tongue. In a population of 100 RR, 100Rr and 100 rr. What is the frequency of allele R? A. 1.00 B. 0.66 C. 0.5 D. 0.33

B

Transcription is performed by: A. DNA polymerases B. DNA dependent RNA polymerases C. Ribosomes D. tRNAs E. all of the above

D

Transcription occurs in: A. Bacteria only B. archaea only C. Eukaryotes only D. all of the above

B

Two different genes are located on the same chromosome, but their exact position is not known. Individual 1 and 2 have the genotypes shown below. The parallel lines represent homologous chromosomes. A. More likely if the two genes are close together on the chromosome B. More likely if the two genes are far apart on the chromosome C. equally likely no matter where the genes are located on the chromosome

B

What is the feature on a chromosome that initiates a DNA replication bubble? A. Promoter B. An origin of replication C. The Start codon D. all of the above

A

What is the feature on a gene that can help initiate its transcription by an RNA Polymerase? A. the promoter B. An origin of replication C. The start codon D. All of the above

A

Which of the following distinguishes prophase of meiosis I from prophase of mitosis? A. homologous chromosome pairs up B. spindle forms C. nuclear membrane breaks down D. chromosomes become visible

C

Which pedigree is most consistent with an X-linked recessive inheritance pattern?

C

Yellow pea color (Y) is dominant to green pea color (y). Round seed shape (R) is dominant to oval pea shape (r). let's say the genes responsible for these phenotypes are on the same chromosome. Which of the following genotypes should result in a yellow pea plant with round seeds? The parallel lines represent homologous chromosomes. A. Genotype #! B. Genotype #2 C. both genotypes D. Neither genotypes

D

You are managing two isolated populations of pine marten ( a native mammal) in Maine. Each population has a neutral recessive mutation that codes for fluffier tails. Both start with the allele frequency at 50%. Over a 10 year period, the allele frequency in population 1 increases from 50% to 65%. Over the same period what do you predict will happen in Population 2? A. the frequency of fluffier tails will increase B. the frequency of fluffier tails will decrease C. the frequency of fluffier tails will stay the same D. we cannot predict what will happen

C

You are working on a mouse model for deafness and have established a homozygous strain of mice that cannot hear. You call this mouse strain #1 and have determined that the phenotype is caused by a recessive allele in a single gene. You learn that a colleague has isolated another homozygous strain of mice that is called strain #2, which is also deaf because of a recessive allele in a single gene. Finally, a third colleague has isolated a homozygous strain of mice that are deaf. The phenotype associated with strain #3 is also caused by a recessive allele in a single gene. You cross a true-breeding strain #1 mouse to a true-breeding #2 mouse and find that the F1 progeny can hear. IN another experiment, you cross a true-breeding strain #1 mouse to a true breeding #3 mouse and find that all of the F1 progeny are deaf. Based on this data, what do you predict the phenotype of the F1 progeny will be when you cross a true-breeding strain #2 mouse to a true-breeding strain #3 mouse? A. 50% of the mice will be deaf B. 100% of the mice will be deaf C. None of the mice will be deaf D. There is not enough information in this question to determine the outcome

B

You are working on a mouse model for deafness and have established a homozygous strain of mice that cannot hear. You call this mouse strain #1 and have determined that the phenotype is caused by a recessive allele in a single gene. You learn that a colleague has isolated another homozygous strain of mice that is called strain #2, which is also deaf because of a recessive allele in a single gene. Finally, a third colleague has isolated a homozygous strain of mice that are deaf. The phenotype associated with strain #3 is also caused by a recessive allele in a single gene. You cross a true-breeding strain #1 mouse to a true-breeding #2 mouse and find that the F1 progeny can hear. In another experiment, you cross a true-breeding strain #1 mouse to a true breeding #3 mouse and find that all of the F1 progeny are deaf. You cross a strain #1 mouse to a strain #2 mouse and get F1 progeny. If you cross the F1 progeny together, what fraction of mice do you predict will be deaf in the F2 generation? A. 9/16 B. 7/16 C. 4/16 D. 3/16 E. 1/16

A

You cross a hairless mouse aaBB to a mouse with curly hair AAbb. All of the F1's have straight hair. You cross two of the F1 mice together. In the F2 generation: 9 mice have straight hair, 4 mice are hairless and 3 have curly hair. What is the likely phenotype of the aabb mice in the F2 generation? A. hairless B. Curly haired C. Straight haired

C

You cross the RrYy F1 individual with the RRYY parent. This type of cross is often referred to as a back cross. What are predicted ratios and associated phenotypes from this back cross? A. 1:1 (Round yellow: wrinkled green) B. 9:3:3:1 (Round yellow: round green: wrinkled yellow: wrinkled green) C. 100% Round yellow D. 100% Wrinkled Green

B

You discover a mother, daughter and son who cannot see well in bright daylight. You look for mutations shared by the mother, daughter and son and find that they will also carry a new mutation in the gene hBEC2 (no one else generation I and II in the family has this mutation). IN addition to the mutant allele, they also carry a copy of the normal allele. hBEC2 is located on human chromosome 12. III-1 and III-2 are both currently babies, who vision in bright sunlight is not testable yet. These babies have not undergone genetic testing yet. What is the probability that BOTH cousins will have normal vision when they grow up? A. 0 B. 1/4 C. 1/2 D. 3/4 E. 1

A

You discover a mother, daughter and son who cannot see well in bright daylight. You look for mutations shared by the mother, daughter and son and find that they will also carry a new mutation in the gene hBEC2 (no one else generation I and II in the family has this mutation). IN addition to the mutant allele, they also carry a copy of the normal allele. hBEC2 is located on human chromosome 12. What is the most likely inheritance pattern for not seeing well in bright daylight? A. autosomal dominant B. autosomal recessive C. x-linked dominant D. x-linked recessive E. more than one of the above is possible

B

You make a salad contain spinach, tomato, and carrot. When you eat this salad, are you eating DNA? A. Only if the veggies you are eating are genetically modified B. Yes C. No

C

You want to study the linkage between black and green in fish so you do this cross: What is the recombination frequency between black and green? A. 15 cM B. 13 cM C. 28 cM D. 51 cM E. 72 cM

A

Your lab has decided to study albino fish. You know that albinism is controlled by multiple genes and is inherited in a recessive manner. You gather 10 mutant albino fish from various cave ponds in Mexico. You mate the fish together (don't worry about sex) and get the following results: "-" phenotype represents an albino fish, "+" phenotype represents a fish that is wild-type in color, "?" means you have no done the experiment yet. WT stands for wild-type (non-albino) fish. If you cross strain 1 with strain 5, you would predict the progeny will be: A. 100% albino B. 75% albino C. 50% albino D. 25% albino E. 0% albino

C

Your lab has decided to study albino fish. You know that albinism is controlled by multiple genes and is inherited in a recessive manner. You gather 10 mutant albino fish from various cave ponds in Mexico. You mate the fish together (don't worry about sex) and get the following results: "-" phenotype represents an albino fish, "+" phenotype represents a fish that is wild-type in color, "?" means you have no done the experiment yet. WT stands for wild-type (non-albino) fish. If you cross strain 7 with strain 3 it will result in: A. + B. - C. You need to do more crosses to decide

C

let's say fur color in rabbits is represented by F/f and ear color is represented by E/e. A male rabbit has white fur and pink fears: FfEe. A female rabbit has brown fur and pink ears: ffEE. What is the chance that one of their offspring will have white fur and pink ears? A. 0 B. 1/4 C. 1/2 D. 3/4 E. 1